Home > Products > Human MicroRNA Agomir/Antagomir >

MIRacle™ hsa-miR-653-5p miRNA Agomir/Antagomir

Product Name

MIRacle™ hsa-miR-653-5p miRNA Agomir/Antagomir

Price Get Quote
Cat.No

AM2481

Species

Human

Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Description

MicroRNA: hsa-miR-653-5p

Accession Number: MIMAT0003328
Mature Sequence: GUGUUGAAACAAUCUCUACUG

 

hsa-miR-653-5p is a 21-nucleotide-long RNA molecule found in Homo sapiens. It plays a crucial role in various biological processes, including cell proliferation and apoptosis. Through interactions with protein-coding genes such as 182-FIP, 209L8, 5T4, 5T4-AG, 82-FIP, ABI3BP, ABP-280, ADAMTS-4, ADAMTS11, and ADAMTS3, miR-653-5p regulates important cellular functions. In gastric cancer, it has been shown to mediate disease progression and metastasis by modulating the SOCS6-STAT3 signaling pathway. Additionally, hsa-miR-653-5p functions as a tumor suppressor in prostate and breast cancers. In prostate cancer, it inhibits proliferation and invasion by targeting the SOX30 gene and suppressing the Wnt/β-catenin signaling pathway. In breast cancer, miR-653-5p suppresses cell proliferation, migration, and invasion while promoting apoptosis through its interaction with mitogen-activated protein kinase 6 (MAPK6). These findings underscore the significance of the miR-653-5p-mediated regulatory network in the progression of prostate and breast cancers.

 

Click here to browse detailed information about hsa-miR-653-5p in miRBase.

 

Introduction and Application of hsa-miR-653-5p miRNA Agomir/Antagomir

hsa-miR-653-5p miRNA Agomir/Antagomir is a valuable tool for studying the role of microRNA in tumor signaling pathways. The Agomir mimics miR-653-5p to regulate target genes, while the Antagomir inhibits miR-653-5p function. These tools enable researchers to investigate the impact of miR-653-5p on tumor development and identify potential therapeutic targets. They provide insights into non-coding RNA regulation and its involvement in tumor signaling pathways.

 

Why choose hsa-miR-653-5p miRNA Agomir/Antagomir from AcceGen?
MIRacle™ hsa-miR-653-5p miRNA Agomir/Antagomir from AcceGen provides several key features. AcceGen’s synthesis services cover a wide range of microRNAs, including human, mouse, and rat miRNAs in the miRBase. These Agomir and Antagomir products are designed to be more resistant to degradation than standard miRNA mimics and inhibitors. This enhanced stability ensures a lasting effect for a minimum of 1 week, up to 5-6 weeks. They are suitable for both in vitro and in vivo miRNA functional studies, making them versatile tools for investigating microRNA functions.
Recommended Medium And Supplement
Citation Guide

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Label

FAM, CY3, CY5, etc. (optional)

Application

For research use only

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Component

hsa-miR-653-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Product Type

microRNA Agomir/Antagomir

Product Image AcceGen Frozen Cells & Cell Lines AcceGen Frozen Cells & Cell Lines
Tech Document

MIRacle™ Agomir Product Manual

MIRacle™ Antagomir Product Manual

MSDS-AcceGen MicroRNA Agomir

MSDS-AcceGen MicroRNA Antagomir

  • ONLINE INQUIRY
  • PRODUCT REVIEWS
We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time?

Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
Privacy Policy: AcceGen will never sell, rent, or share your personal information with any third parties without your express permission.
Reviews of MIRacle™ hsa-miR-653-5p miRNA Agomir/Antagomir
AcceGen is always trying to do right by our customers and working hard to build a higher quality product.

Your email address will not be published.

AcceGen Scroll Top Button
Copy link