AcceGen Biotech logo Online Inquiry AcceGen search button

Home > Products > MicroRNA Agomir/Antagomir > Rat miRNA Agomir/Antagomir >

MIRacle™ rno-miR-465-3p miRNA Agomir/Antagomir

Cat.#AM5212
TypemicroRNA Agomir/Antagomir
SpeciesRat
Size2 OD, 4 OD, 50 OD(size by request)
Storage-20°C
ShippingIce pack
LabelFAM, CY3
DescriptionAccession Number: MIMAT0017367 Mature Sequence UGAUCAGUGCCUUUCUGAGUAG rno-miR-465-3p are small non-coding RNAs of 20–22 nucleotides, typically excised from 60–110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. AcceGen Biotech has extended experience in agomir/antagomir synthesis services that cover all human, mouse and rat miRNAs in the current miRbase (http://www.mirbase.org/). Compared to standard miRNA mimics and inhibitors, agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies. Deliverables: Agomir and/or antagomir, DEPC H2O. 1 OD corresponds to 33 ug.
Citation GuideIf the product is used for publication, it should be cited in the publication as: “AcceGen Biotech Cat.# XXX-0000”. In addition,click here to submit your paper’s PubMed ID (PMID) to get a $100 coupon.
To request a quote or additional information, please fill out the form below and we will contact you in 24 hours.
refresh
Privacy Policy: AcceGen will never sell, rent, or share your personal information with any third parties without your express permission.

Related Products