Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir
Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM2374 | MIRacle™ hsa-miR-7153-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7153-5p Accession Number: MIMAT0028216 Mature Sequence: UGAGAACUGACAAAUGUGGUAGG hs...more | +inquiry | |
| AM2373 | MIRacle™ hsa-miR-6857-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6857-3p Accession Number: MIMAT0027615 Mature Sequence: UGACUGAGCUUCUCCCCACAG hsa-...more | +inquiry | |
| AM2372 | MIRacle™ hsa-miR-6807-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6807-3p Accession Number: MIMAT0027515 Mature Sequence: CACUGCAUUCCUGCUUGGCCCAG hs...more | +inquiry | |
| AM2371 | MIRacle™ hsa-miR-6757-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6757-3p Accession Number: MIMAT0027415 Mature Sequence: AACACUGGCCUUGCUAUCCCCA hsa...more | +inquiry | |
| AM2370 | MIRacle™ hsa-miR-6506-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6506-3p Accession Number: MIMAT0025469 Mature Sequence: UCGUAUCAGAGAUUCCAGACAC hsa...more | +inquiry | |
| AM2369 | MIRacle™ hsa-miR-5590-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5590-5p Accession Number: MIMAT0022299 Mature Sequence: UUGCCAUACAUAGACUUUAUU hsa-...more | +inquiry | |
| AM2368 | MIRacle™ hsa-miR-5000-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5000-3p Accession Number: MIMAT0021020 Mature Sequence: UCAGGACACUUCUGAACUUGGA hsa...more | +inquiry | |
| AM2367 | MIRacle™ hsa-miR-4752 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4752 Accession Number: MIMAT0019889 Mature Sequence: UUGUGGAUCUCAAGGAUGUGCU hsa-mi...more | +inquiry | |
| AM2366 | MIRacle™ hsa-miR-4697-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4697-3p Accession Number: MIMAT0019792 Mature Sequence: UGUCAGUGACUCCUGCCCCUUGGU h...more | +inquiry | |
| AM2365 | MIRacle™ hsa-miR-4636 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4636 Accession Number: MIMAT0019693 Mature Sequence: AACUCGUGUUCAAAGCCUUUAG hsa-mi...more | +inquiry | |
| AM2364 | MIRacle™ hsa-miR-4477a miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4477a Accession Number: MIMAT0019004 Mature Sequence: CUAUUAAGGACAUUUGUGAUUC hsa-m...more | +inquiry | |
| AM2363 | MIRacle™ hsa-miR-3940-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3940-3p Accession Number: MIMAT0018356 Mature Sequence: CAGCCCGGAUCCCAGCCCACUU hsa...more | +inquiry | |
| AM2362 | MIRacle™ hsa-miR-3653-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3653-5p Accession Number: MIMAT0032110 Mature Sequence: CCUCCUGAUGAUUCUUCUUC hsa-m...more | +inquiry | |
| AM2361 | MIRacle™ hsa-miR-4313 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4313 Accession Number: MIMAT0016865 Mature Sequence: AGCCCCCUGGCCCCAAACCC hsa-miR-...more | +inquiry | |
| AM2360 | MIRacle™ hsa-miR-3074-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3074-3p Accession Number: MIMAT0015027 Mature Sequence: GAUAUCAGCUCAGUAGGCACCG hsa...more | +inquiry | |
| AM2359 | MIRacle™ hsa-miR-1911-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1911-5p Accession Number: MIMAT0007885 Mature Sequence: UGAGUACCGCCAUGUCUGUUGGG hs...more | +inquiry | |
| AM2358 | MIRacle™ hsa-miR-1299 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1299 Accession Number: MIMAT0005887 Mature Sequence: UUCUGGAAUUCUGUGUGAGGGA hsa-mi...more | +inquiry | |
| AM2357 | MIRacle™ hsa-miR-147b miRNA Agomir/Antagomir | MicroRNA: hsa-miR-147b Accession Number: MIMAT0004928 Mature Sequence: GUGUGCGGAAAUGCUUCUGCUA hsa-mi...more | +inquiry | |
| AM2356 | MIRacle™ hsa-miR-661 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-661 Accession Number: MIMAT0003324 Mature Sequence: UGCCUGGGUCUCUGGCCUGCGCGU hsa-m...more | +inquiry | |
| AM2355 | MIRacle™ hsa-miR-583 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-583 Accession Number: MIMAT0003248 Mature Sequence: CAAAGAGGAAGGUCCCAUUAC hsa-miR-...more | +inquiry |
