Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir
Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM2554 | MIRacle™ hsa-miR-517c-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-517c-3p Accession Number: MIMAT0002866 Mature Sequence: AUCGUGCAUCCUUUUAGAGUGU hsa...more | +inquiry | |
| AM2553 | MIRacle™ hsa-miR-452-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-452-5p Accession Number: MIMAT0001635 Mature Sequence: AACUGUUUGCAGAGGAAACUGA hsa-...more | +inquiry | |
| AM2552 | MIRacle™ hsa-miR-365b-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-365b-3p Accession Number: MIMAT0022834 Mature Sequence: UAAUGCCCCUAAAAAUCCUUAU hsa...more | +inquiry | |
| AM2551 | MIRacle™ hsa-miR-140-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-140-3p Accession Number: MIMAT0004597 Mature Sequence: UACCACAGGGUAGAACCACGG hsa-m...more | +inquiry | |
| AM2550 | MIRacle™ hsa-miR-148a-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-148a-3p Accession Number: MIMAT0000243 Mature Sequence: UCAGUGCACUACAGAACUUUGU hsa...more | +inquiry | |
| AM2549 | MIRacle™ hsa-miR-7156-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7156-3p Accession Number: MIMAT0028223 Mature Sequence: CUGCAGCCACUUGGGGAACUGGU hs...more | +inquiry | |
| AM2548 | MIRacle™ hsa-miR-6860 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6860 Accession Number: MIMAT0027622 Mature Sequence: ACUGGGCAGGGCUGUGGUGAGU hsa-mi...more | +inquiry | |
| AM2547 | MIRacle™ hsa-miR-6811-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6811-5p Accession Number: MIMAT0027522 Mature Sequence: AUGCAGGCCUGUGUACAGCACU hsa...more | +inquiry | |
| AM2546 | MIRacle™ hsa-miR-6761-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6761-5p Accession Number: MIMAT0027422 Mature Sequence: UCUGAGAGAGCUCGAUGGCAG hsa-...more | +inquiry | |
| AM2545 | MIRacle™ hsa-miR-6510-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6510-5p Accession Number: MIMAT0025476 Mature Sequence: CAGCAGGGGAGAGAGAGGAGUC hsa...more | +inquiry | |
| AM2544 | MIRacle™ hsa-miR-5681a miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5681a Accession Number: MIMAT0022469 Mature Sequence: AGAAAGGGUGGCAAUACCUCUU hsa-m...more | +inquiry | |
| AM2543 | MIRacle™ hsa-miR-5004-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5004-5p Accession Number: MIMAT0021027 Mature Sequence: UGAGGACAGGGCAAAUUCACGA hsa...more | +inquiry | |
| AM2542 | MIRacle™ hsa-miR-4755-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4755-3p Accession Number: MIMAT0019896 Mature Sequence: AGCCAGGCUCUGAAGGGAAAGU hsa...more | +inquiry | |
| AM2541 | MIRacle™ hsa-miR-4701-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4701-3p Accession Number: MIMAT0019799 Mature Sequence: AUGGGUGAUGGGUGUGGUGU hsa-m...more | +inquiry | |
| AM2540 | MIRacle™ hsa-miR-4640-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4640-3p Accession Number: MIMAT0019700 Mature Sequence: CACCCCCUGUUUCCUGGCCCAC hsa...more | +inquiry | |
| AM2539 | MIRacle™ hsa-miR-4479 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4479 Accession Number: MIMAT0019011 Mature Sequence: CGCGCGGCCGUGCUCGGAGCAG hsa-mi...more | +inquiry | |
| AM2538 | MIRacle™ hsa-miR-3945 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3945 Accession Number: MIMAT0018361 Mature Sequence: AGGGCAUAGGAGAGGGUUGAUAU hsa-m...more | +inquiry | |
| AM2537 | MIRacle™ hsa-miR-1273e miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1273e Accession Number: MIMAT0018079 Mature Sequence: UUGCUUGAACCCAGGAAGUGGA hsa-m...more | +inquiry | |
| AM2536 | MIRacle™ hsa-miR-4317 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4317 Accession Number: MIMAT0016872 Mature Sequence: ACAUUGCCAGGGAGUUU hsa-miR-431...more | +inquiry | |
| AM2535 | MIRacle™ hsa-miR-3158-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3158-5p Accession Number: MIMAT0019211 Mature Sequence: CCUGCAGAGAGGAAGCCCUUC hsa-...more | +inquiry |
