Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir
Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM2474 | MIRacle™ hsa-miR-7155-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7155-5p Accession Number: MIMAT0028220 Mature Sequence: UCUGGGGUCUUGGGCCAUC hsa-mi...more | +inquiry | |
| AM2473 | MIRacle™ hsa-miR-6859-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6859-3p Accession Number: MIMAT0027619 Mature Sequence: UGACCCCCAUGUCGCCUCUGUAG hs...more | +inquiry | |
| AM2472 | MIRacle™ hsa-miR-6809-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6809-3p Accession Number: MIMAT0027519 Mature Sequence: CUUCUCUUCUCUCCUUCCCAG hsa-...more | +inquiry | |
| AM2471 | MIRacle™ hsa-miR-6759-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6759-3p Accession Number: MIMAT0027419 Mature Sequence: UGACCUUUGCCUCUCCCCUCAG hsa...more | +inquiry | |
| AM2470 | MIRacle™ hsa-miR-6508-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6508-3p Accession Number: MIMAT0025473 Mature Sequence: UGGGCCAUGCAUUUCUAGAACU hsa...more | +inquiry | |
| AM2469 | MIRacle™ hsa-miR-548av-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-548av-5p Accession Number: MIMAT0022303 Mature Sequence: AAAAGUACUUGCGGAUUU hsa-mi...more | +inquiry | |
| AM2468 | MIRacle™ hsa-miR-5002-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5002-3p Accession Number: MIMAT0021024 Mature Sequence: UGACUGCCUCACUGACCACUU hsa-...more | +inquiry | |
| AM2467 | MIRacle™ hsa-miR-371b-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-371b-3p Accession Number: MIMAT0019893 Mature Sequence: AAGUGCCCCCACAGUUUGAGUGC hs...more | +inquiry | |
| AM2466 | MIRacle™ hsa-miR-4700-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4700-5p Accession Number: MIMAT0019796 Mature Sequence: UCUGGGGAUGAGGACAGUGUGU hsa...more | +inquiry | |
| AM2465 | MIRacle™ hsa-miR-4639-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4639-5p Accession Number: MIMAT0019697 Mature Sequence: UUGCUAAGUAGGCUGAGAUUGA hsa...more | +inquiry | |
| AM2464 | MIRacle™ hsa-miR-3689d miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3689d Accession Number: MIMAT0019008 Mature Sequence: GGGAGGUGUGAUCUCACACUCG hsa-m...more | +inquiry | |
| AM2463 | MIRacle™ hsa-miR-3943 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3943 Accession Number: MIMAT0018359 Mature Sequence: UAGCCCCCAGGCUUCACUUGGCG hsa-m...more | +inquiry | |
| AM2462 | MIRacle™ hsa-miR-3656 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3656 Accession Number: MIMAT0018076 Mature Sequence: GGCGGGUGCGGGGGUGG hsa-miR-365...more | +inquiry | |
| AM2461 | MIRacle™ hsa-miR-4318 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4318 Accession Number: MIMAT0016869 Mature Sequence: CACUGUGGGUACAUGCU hsa-miR-431...more | +inquiry | |
| AM2460 | MIRacle™ hsa-miR-3156-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3156-3p Accession Number: MIMAT0019209 Mature Sequence: CUCCCACUUCCAGAUCUUUCU hsa-...more | +inquiry | |
| AM2459 | MIRacle™ hsa-miR-1914-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1914-5p Accession Number: MIMAT0007889 Mature Sequence: CCCUGUGCCCGGCCCACUUCUG hsa...more | +inquiry | |
| AM2458 | MIRacle™ hsa-miR-1304-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1304-5p Accession Number: MIMAT0005892 Mature Sequence: UUUGAGGCUACAGUGAGAUGUG hsa...more | +inquiry | |
| AM2457 | MIRacle™ hsa-miR-885-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-885-5p Accession Number: MIMAT0004947 Mature Sequence: UCCAUUACACUACCCUGCCUCU hsa-...more | +inquiry | |
| AM2456 | MIRacle™ hsa-miR-449b-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-449b-3p Accession Number: MIMAT0009203 Mature Sequence: CAGCCACAACUACCCUGCCACU hsa...more | +inquiry | |
| AM2455 | MIRacle™ hsa-miR-585-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-585-3p Accession Number: MIMAT0003250 Mature Sequence: UGGGCGUAUCUGUAUGCUA hsa-miR...more | +inquiry |
