Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir
Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM2454 | MIRacle™ hsa-miR-518a-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-518a-5p Accession Number: MIMAT0005457 Mature Sequence: CUGCAAAGGGAAGCCCUUUC hsa-m...more | +inquiry | |
| AM2453 | MIRacle™ hsa-miR-433-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-433-3p Accession Number: MIMAT0001627 Mature Sequence: AUCAUGAUGGGCUCCUCGGUGU hsa-...more | +inquiry | |
| AM2452 | MIRacle™ hsa-miR-363-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-363-3p Accession Number: MIMAT0000707 Mature Sequence: AAUUGCACGGUAUCCAUCUGUA hsa-...more | +inquiry | |
| AM2451 | MIRacle™ hsa-miR-137 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-137 Accession Number: MIMAT0000429 Mature Sequence: UUAUUGCUUAAGAAUACGCGUAG hsa-mi...more | +inquiry | |
| AM2450 | MIRacle™ hsa-miR-208a-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-208a-3p Accession Number: MIMAT0000241 Mature Sequence: AUAAGACGAGCAAAAAGCUUGU hsa...more | +inquiry | |
| AM2449 | MIRacle™ hsa-miR-7154-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7154-3p Accession Number: MIMAT0028219 Mature Sequence: AGGAGGACAAGUUGUGGGAU hsa-m...more | +inquiry | |
| AM2448 | MIRacle™ hsa-miR-6859-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6859-5p Accession Number: MIMAT0027618 Mature Sequence: GAGAGGAACAUGGGCUCAGGACA hs...more | +inquiry | |
| AM2447 | MIRacle™ hsa-miR-6809-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6809-5p Accession Number: MIMAT0027518 Mature Sequence: UGGCAAGGAAAGAAGAGGAUCA hsa...more | +inquiry | |
| AM2446 | MIRacle™ hsa-miR-6759-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6759-5p Accession Number: MIMAT0027418 Mature Sequence: UUGUGGGUGGGCAGAAGUCUGU hsa...more | +inquiry | |
| AM2445 | MIRacle™ hsa-miR-6508-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6508-5p Accession Number: MIMAT0025472 Mature Sequence: UCUAGAAAUGCAUGACCCACC hsa-...more | +inquiry | |
| AM2444 | MIRacle™ hsa-miR-5591-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5591-3p Accession Number: MIMAT0022302 Mature Sequence: AUACCCAUAGCUUAGCUCCCA hsa-...more | +inquiry | |
| AM2443 | MIRacle™ hsa-miR-5002-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5002-5p Accession Number: MIMAT0021023 Mature Sequence: AAUUUGGUUUCUGAGGCACUUAGU h...more | +inquiry | |
| AM2442 | MIRacle™ hsa-miR-371b-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-371b-5p Accession Number: MIMAT0019892 Mature Sequence: ACUCAAAAGAUGGCGGCACUUU hsa...more | +inquiry | |
| AM2441 | MIRacle™ hsa-miR-4699-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4699-3p Accession Number: MIMAT0019795 Mature Sequence: AAUUUACUCUGCAAUCUUCUCC hsa...more | +inquiry | |
| AM2440 | MIRacle™ hsa-miR-4638-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4638-3p Accession Number: MIMAT0019696 Mature Sequence: CCUGGACACCGCUCAGCCGGCCG hs...more | +inquiry | |
| AM2439 | MIRacle™ hsa-miR-3689c miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3689c Accession Number: MIMAT0019007 Mature Sequence: CUGGGAGGUGUGAUAUUGUGGU hsa-m...more | +inquiry | |
| AM2438 | MIRacle™ hsa-miR-3942-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3942-3p Accession Number: MIMAT0019230 Mature Sequence: UUUCAGAUAACAGUAUUACAU hsa-...more | +inquiry | |
| AM2437 | MIRacle™ hsa-miR-3655 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3655 Accession Number: MIMAT0018075 Mature Sequence: GCUUGUCGCUGCGGUGUUGCU hsa-miR...more | +inquiry | |
| AM2436 | MIRacle™ hsa-miR-4314 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4314 Accession Number: MIMAT0016868 Mature Sequence: CUCUGGGAAAUGGGACAG hsa-miR-43...more | +inquiry | |
| AM2435 | MIRacle™ hsa-miR-3156-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3156-5p Accession Number: MIMAT0015030 Mature Sequence: AAAGAUCUGGAAGUGGGAGACA hsa...more | +inquiry |
