Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM3967

MIRacle™ mmu-miR-6991-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6991-3p Accession Number: MIMAT0027885 Mature Sequence: GCAGCCCUUUGUUCUUCUCCAG mmu...more +inquiry

AM3983

MIRacle™ mmu-miR-465b-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-465b-5p Accession Number: MIMAT0004871 Mature Sequence: UAUUUAGAAUGGUGCUGAUCUG mmu...more +inquiry

AM3999

MIRacle™ mmu-miR-7682-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7682-5p Accession Number: MIMAT0029884 Mature Sequence: AGGCACGACUCUUGCCACAGAAAC m...more +inquiry

AM4015

MIRacle™ mmu-miR-5125 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5125 Accession Number: MIMAT0020635 Mature Sequence: UCUGCCUGGGAUUUCCUUGU mmu-miR-...more +inquiry

AM4031

MIRacle™ mmu-miR-33-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-33-3p Accession Number: MIMAT0004666 Mature Sequence: CAAUGUUUCCACAGUGCAUCAC mmu-m...more +inquiry

AM4047

MIRacle™ mmu-miR-6995-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6995-3p Accession Number: MIMAT0027893 Mature Sequence: UGUGUCCCCUUCCUCUCACAG mmu-...more +inquiry

AM4063

MIRacle™ mmu-miR-466e-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-466e-5p Accession Number: MIMAT0004879 Mature Sequence: GAUGUGUGUGUACAUGUACAUA mmu...more +inquiry

AM4079

MIRacle™ mmu-miR-219c-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-219c-5p Accession Number: MIMAT0029892 Mature Sequence: GGACGUCCAGACGCAACUCUCG mmu...more +inquiry

AM4095

MIRacle™ mmu-miR-5130 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5130 Accession Number: MIMAT0020641 Mature Sequence: CUGGAGCGCGCGGGCGAGGCAGGC mmu-...more +inquiry

AM4111

MIRacle™ mmu-miR-224-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-224-3p Accession Number: MIMAT0017062 Mature Sequence: AAAUGGUGCCCUAGUGACUACA mmu-...more +inquiry

AM4127

MIRacle™ mmu-miR-6999-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6999-3p Accession Number: MIMAT0027901 Mature Sequence: CUUCAGCUGUCCUCCUUUCUGU mmu...more +inquiry

AM4143

MIRacle™ mmu-miR-467c-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-467c-3p Accession Number: MIMAT0017275 Mature Sequence: AUAUACAUACACACACCUAUAC mmu...more +inquiry

AM4159

MIRacle™ mmu-miR-290b-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-290b-5p Accession Number: MIMAT0029900 Mature Sequence: GCUUAAAACUAGGCGGCACUUU mmu...more +inquiry

AM4175

MIRacle™ mmu-miR-5136 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5136 Accession Number: MIMAT0020647 Mature Sequence: AUAUGCGAGGGAACUACUGG mmu-miR-...more +inquiry

AM4191

MIRacle™ mmu-miR-181b-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-181b-5p Accession Number: MIMAT0000673 Mature Sequence: AACAUUCAUUGCUGUCGGUGGGU mm...more +inquiry

AM4207

MIRacle™ mmu-miR-6973b-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6973b-3p Accession Number: MIMAT0027909 Mature Sequence: UGCUCUCUUACCCUUCCUAG mmu-...more +inquiry

AM4223

MIRacle™ mmu-miR-509-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-509-3p Accession Number: MIMAT0004891 Mature Sequence: UGAUUGACAUUUCUGUAAUGG mmu-m...more +inquiry

AM4239

MIRacle™ mmu-miR-7689-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7689-5p Accession Number: MIMAT0029908 Mature Sequence: CCGAGGCAGCCUGGCUUAG mmu-mi...more +inquiry

AM4255

MIRacle™ mmu-miR-1231-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1231-3p Accession Number: MIMAT0022358 Mature Sequence: UGCCCUGUCUGUUCUGCCCACAG mm...more +inquiry

AM4271

MIRacle™ mmu-miR-7a-2-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7a-2-3p Accession Number: MIMAT0017070 Mature Sequence: CAACAAGUCCCAGUCUGCCACA mmu...more +inquiry
AcceGen Scroll Top Button