Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM4179

MIRacle™ mmu-miR-7687-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7687-5p Accession Number: MIMAT0029902 Mature Sequence: AGGCGGGGAACCUGAGGCGCAGGCU ...more +inquiry

AM4195

MIRacle™ mmu-miR-3544-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3544-3p Accession Number: MIMAT0022354 Mature Sequence: ACUCCUGCAUGACGCCGUUCCC mmu...more +inquiry

AM4211

MIRacle™ mmu-miR-181c-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-181c-5p Accession Number: MIMAT0000674 Mature Sequence: AACAUUCAACCUGUCGGUGAGU mmu...more +inquiry

AM4227

MIRacle™ mmu-miR-7003-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7003-3p Accession Number: MIMAT0027911 Mature Sequence: CCCCGGGUUUUCCCCACAG mmu-mi...more +inquiry

AM4243

MIRacle™ mmu-miR-574-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-574-5p Accession Number: MIMAT0004893 Mature Sequence: UGAGUGUGUGUGUGUGAGUGUGU mmu...more +inquiry

AM4259

MIRacle™ mmu-miR-7243-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7243-5p Accession Number: MIMAT0029910 Mature Sequence: UGCUGUCAGCUGUUCUGAGU mmu-m...more +inquiry

AM4275

MIRacle™ mmu-miR-5616-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5616-3p Accession Number: MIMAT0022360 Mature Sequence: AACUUGUGAUGAGGUGAGACAG mmu...more +inquiry

AM4291

MIRacle™ mmu-miR-7b-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7b-3p Accession Number: MIMAT0017071 Mature Sequence: CAACAAGUCACAGCCAGCCUCA mmu-m...more +inquiry

AM4307

MIRacle™ mmu-miR-7007-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7007-3p Accession Number: MIMAT0027919 Mature Sequence: CCCAUCCACGUUUCUUCU mmu-miR...more +inquiry

AM4323

MIRacle™ mmu-miR-466d-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-466d-5p Accession Number: MIMAT0004930 Mature Sequence: UGUGUGUGCGUACAUGUACAUG mmu...more +inquiry

AM4339

MIRacle™ mmu-miR-8095 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8095 Accession Number: MIMAT0031396 Mature Sequence: AAAGGAUUCUGCUGUCUGUCCC mmu-mi...more +inquiry

AM4355

MIRacle™ mmu-miR-5620-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5620-3p Accession Number: MIMAT0022368 Mature Sequence: ACAGUCAUCCCCCUGCCUCAC mmu-...more +inquiry

AM4371

MIRacle™ mmu-miR-362-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-362-3p Accession Number: MIMAT0004684 Mature Sequence: AACACACCUGUUCAAGGAUUCA mmu-...more +inquiry

AM4387

MIRacle™ mmu-miR-7011-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7011-3p Accession Number: MIMAT0027927 Mature Sequence: UCUGCUUCCCUCCUCCUCUAG mmu-...more +inquiry

AM4403

MIRacle™ mmu-miR-873a-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-873a-3p Accession Number: MIMAT0017279 Mature Sequence: GAGACUGACAAGUUCCCGGGA mmu-...more +inquiry

AM4419

MIRacle™ mmu-miR-497b miRNA Agomir/Antagomir

MicroRNA: mmu-miR-497b Accession Number: MIMAT0031404 Mature Sequence: CACCACAGUGUGGUUUGGACGUGG mmu-...more +inquiry

AM4435

MIRacle™ mmu-miR-3073b-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3073b-3p Accession Number: MIMAT0022376 Mature Sequence: CUGGCGCCAACUGUGACCACUG mm...more +inquiry

AM4451

MIRacle™ mmu-miR-376a-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-376a-3p Accession Number: MIMAT0000740 Mature Sequence: AUCGUAGAGGAAAAUCCACGU mmu-...more +inquiry

AM4467

MIRacle™ mmu-miR-7015-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7015-3p Accession Number: MIMAT0027935 Mature Sequence: UCUCACUGUCCUCUGCACUAG mmu-...more +inquiry

AM4483

MIRacle™ mmu-miR-511-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-511-3p Accession Number: MIMAT0017281 Mature Sequence: AAUGUGUAGCAAAAGACAGGAU mmu-...more +inquiry
AcceGen Scroll Top Button