Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM5234

MIRacle™ rno-miR-344i miRNA Agomir/Antagomir

MicroRNA: rno-miR-344i Accession Number: MIMAT0025049 Mature Sequence CUCUAGCCAGGGCUUGACUGCA rno-mi...more +inquiry

AM5233

MIRacle™ rno-miR-3572 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3572 Accession Number: MIMAT0017853 Mature Sequence UUACACUUGCCCUUUUUUCCCCAG rno-...more +inquiry

AM5232

MIRacle™ rno-miR-547-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-547-3p Accession Number: MIMAT0012851 Mature Sequence AUUGGUACUUCUUUAAGUGAGA rno-...more +inquiry

AM5231

MIRacle™ rno-miR-672-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-672-3p Accession Number: MIMAT0017312 Mature Sequence ACACACAGUCGCCAUCUUCGA rno-m...more +inquiry

AM5230

MIRacle™ rno-miR-497-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-497-5p Accession Number: MIMAT0003383 Mature Sequence CAGCAGCACACUGUGGUUUGUA rno-...more +inquiry

AM5229

MIRacle™ rno-miR-501-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-501-5p Accession Number: MIMAT0003116 Mature Sequence AAUCCUUUGUCCCUGGGUGA rno-mi...more +inquiry

AM5228

MIRacle™ rno-miR-204-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-204-3p Accession Number: MIMAT0004739 Mature Sequence GCUGGGAAGGCAAAGGGACGUU rno-...more +inquiry

AM5227

MIRacle™ rno-miR-136-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-136-5p Accession Number: MIMAT0000842 Mature Sequence ACUCCAUUUGUUUUGAUGAUGGA rno...more +inquiry

AM5226

MIRacle™ rno-miR-30d-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30d-5p Accession Number: MIMAT0000807 Mature Sequence UGUAAACAUCCCCGACUGGAAG rno-...more +inquiry

AM5225

MIRacle™ rno-let-7a-2-3p miRNA Agomir/Antagomir

MicroRNA: rno-let-7a-2-3p Accession Number: MIMAT0017086 Mature Sequence CUGUACAGCCUCCUAGCUUUCC rno...more +inquiry

AM5224

MIRacle™ rno-miR-3099 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3099 Accession Number: MIMAT0025048 Mature Sequence UAGGCUAGAAAGAGGUUGGGGA rno-mi...more +inquiry

AM5223

MIRacle™ rno-miR-1949 miRNA Agomir/Antagomir

MicroRNA: rno-miR-1949 Accession Number: MIMAT0017852 Mature Sequence UAUACCAGGAUGUCAGCAUAGUU rno-m...more +inquiry

AM5222

MIRacle™ rno-miR-547-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-547-5p Accession Number: MIMAT0017368 Mature Sequence UCACUUCAGGAUGUACCACCCA rno-...more +inquiry

AM5221

MIRacle™ rno-miR-672-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-672-5p Accession Number: MIMAT0005327 Mature Sequence UGAGGUUGGUGUACUGUGUGUGA rno...more +inquiry

AM5220

MIRacle™ rno-miR-664-2-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-664-2-5p Accession Number: MIMAT0017229 Mature Sequence CUGGCUGGGGAAAAUGAUUGG rno...more +inquiry

AM5219

MIRacle™ rno-miR-207 miRNA Agomir/Antagomir

MicroRNA: rno-miR-207 Accession Number: MIMAT0003115 Mature Sequence CUUCUCCUGGCUCUCCUCCCUUU rno-mi...more +inquiry

AM5218

MIRacle™ rno-miR-204-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-204-5p Accession Number: MIMAT0000877 Mature Sequence UUCCCUUUGUCAUCCUAUGCCU rno-...more +inquiry

AM5217

MIRacle™ rno-miR-135a-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-135a-3p Accession Number: MIMAT0004732 Mature Sequence UGUAGGGAUGGAAGCCAUGAAA rno...more +inquiry

AM5216

MIRacle™ rno-miR-30b-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30b-3p Accession Number: MIMAT0004721 Mature Sequence CUGGGAUGUGGAUGUUUACGUC rno-...more +inquiry

AM5215

MIRacle™ rno-let-7a-1-3p miRNA Agomir/Antagomir

MicroRNA: rno-let-7a-1-3p Accession Number: MIMAT0017085 Mature Sequence CUAUACAAUCUACUGUCUUUCC rno...more +inquiry
AcceGen Scroll Top Button