Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM0014

MIRacle™ hsa-miR-374c-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-374c-3p Accession Number: MIMAT0022735 Mature Sequence: CACUUAGCAGGUUGUAUUAUAU hsa...more +inquiry

AM0013

MIRacle™ hsa-miR-3660 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3660 Accession Number: MIMAT0018081 Mature Sequence: ACUGACAGGAGAGCAUUUUGA hsa-miR...more +inquiry

AM0012

MIRacle™ hsa-miR-4321 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4321 Accession Number: MIMAT0016874 Mature Sequence: UUAGCGGUGGACCGCCCUGCG hsa-miR...more +inquiry

AM0011

MIRacle™ hsa-miR-3159 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3159 Accession Number: MIMAT0015033 Mature Sequence: UAGGAUUACAAGUGUCGGCCAC hsa-mi...more +inquiry

AM0010

MIRacle™ hsa-miR-1973 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1973 Accession Number: MIMAT0009448 Mature Sequence: ACCGUGCAAAGGUAGCAUA hsa-miR-1...more +inquiry

AM0009

MIRacle™ hsa-miR-548f-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-548f-3p Accession Number: MIMAT0005895 Mature Sequence: AAAAACUGUAAUUACUUUU hsa-mi...more +inquiry

AM0008

MIRacle™ hsa-miR-887-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-887-3p Accession Number: MIMAT0004951 Mature Sequence: GUGAACGGGCGCCAUCCCGAGG hsa-...more +inquiry

AM0007

MIRacle™ hsa-miR-654-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-654-5p Accession Number: MIMAT0003330 Mature Sequence: UGGUGGGCCGCAGAACAUGUGC hsa-...more +inquiry

AM0006

MIRacle™ hsa-miR-548b-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-548b-3p Accession Number: MIMAT0003254 Mature Sequence: CAAGAACCUCAGUUGCUUUUGU hsa...more +inquiry

AM0005

MIRacle™ hsa-miR-520h miRNA Agomir/Antagomir

MicroRNA: hsa-miR-520h Accession Number: MIMAT0002867 Mature Sequence: ACAAAGUGCUUCCCUUUAGAGU hsa-mi...more +inquiry

AM0004

MIRacle™ hsa-miR-452-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-452-3p Accession Number: MIMAT0001636 Mature Sequence: CUCAUCUGCAAAGAAGUAAGUG hsa-...more +inquiry

AM0003

MIRacle™ hsa-miR-302b-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-302b-5p Accession Number: MIMAT0000714 Mature Sequence: ACUUUAACAUGGAAGUGCUUUC hsa...more +inquiry

AM0002

MIRacle™ hsa-miR-141-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-141-5p Accession Number: MIMAT0004598 Mature Sequence: CAUCUUCCAGUACAGUGUUGGA hsa-...more +inquiry

AM0001

MIRacle™ hsa-miR-30c-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-30c-5p Accession Number: MIMAT0000244 Mature Sequence: UGUAAACAUCCUACACUCUCAGC hsa...more +inquiry
AcceGen Scroll Top Button