Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM0141

MIRacle™ hsa-miR-4646-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4646-5p Accession Number: MIMAT0019707 Mature Sequence: ACUGGGAAGAGGAGCUGAGGGA hsa...more +inquiry

AM0157

MIRacle™ hsa-miR-549a miRNA Agomir/Antagomir

MicroRNA: hsa-miR-549a Accession Number: MIMAT0003333 Mature Sequence: UGACAACUAUGGAUGAGCUCU hsa-miR...more +inquiry

AM0173

MIRacle™ hsa-miR-6815-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6815-5p Accession Number: MIMAT0027530 Mature Sequence: UAGGUGGCGCCGGAGGAGUCAUU hs...more +inquiry

AM0014

MIRacle™ hsa-miR-374c-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-374c-3p Accession Number: MIMAT0022735 Mature Sequence: CACUUAGCAGGUUGUAUUAUAU hsa...more +inquiry

AM0030

MIRacle™ hsa-miR-522-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-522-5p Accession Number: MIMAT0005451 Mature Sequence: CUCUAGAGGGAAGCGCUUUCUG hsa-...more +inquiry

AM0046

MIRacle™ hsa-miR-6511a-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6511a-3p Accession Number: MIMAT0025479 Mature Sequence: CCUCACCAUCCCUUCUGCCUGC hs...more +inquiry

AM0062

MIRacle™ hsa-miR-4324 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4324 Accession Number: MIMAT0016876 Mature Sequence: CCCUGAGACCCUAACCUUAA hsa-miR-...more +inquiry

AM0078

MIRacle™ hsa-miR-302c-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-302c-3p Accession Number: MIMAT0000717 Mature Sequence: UAAGUGCUUCCAUGUUUCAGUGG hs...more +inquiry

AM0094

MIRacle™ hsa-miR-5006-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5006-3p Accession Number: MIMAT0021034 Mature Sequence: UUUCCCUUUCCAUCCUGGCAG hsa-...more +inquiry

AM0110

MIRacle™ hsa-miR-2054 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-2054 Accession Number: MIMAT0009979 Mature Sequence: CUGUAAUAUAAAUUUAAUUUAUU hsa-m...more +inquiry

AM0126

MIRacle™ hsa-miR-139-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-139-3p Accession Number: MIMAT0004552 Mature Sequence: UGGAGACGCGGCCCUGUUGGAGU hsa...more +inquiry

AM0142

MIRacle™ hsa-miR-4707-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4707-5p Accession Number: MIMAT0019807 Mature Sequence: GCCCCGGCGCGGGCGGGUUCUGG hs...more +inquiry

AM0158

MIRacle™ hsa-miR-374b-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-374b-3p Accession Number: MIMAT0004956 Mature Sequence: CUUAGCAGGUUGUAUUAUCAUU hsa...more +inquiry

AM0174

MIRacle™ hsa-miR-6865-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6865-5p Accession Number: MIMAT0027630 Mature Sequence: UAGGUGGCAGAGGAGGGACUUCA hs...more +inquiry
AcceGen Scroll Top Button