Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.


  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.# Name Description Price


MIRacle™ rno-miR-6314 miRNA Agomir/Antagomir

MicroRNA: rno-miR-6314 Accession Number: MIMAT0025047 Mature Sequence AGGCACUGACAGAUCUGAUGGU rno-mi...more +inquiry


MIRacle™ rno-miR-3571 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3571 Accession Number: MIMAT0017851 Mature Sequence UACACACUUCUUUACAUUCCAUA rno-m...more +inquiry


MIRacle™ rno-miR-465-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-465-3p Accession Number: MIMAT0017367 Mature Sequence UGAUCAGUGCCUUUCUGAGUAG rno-...more +inquiry


MIRacle™ rno-miR-671 miRNA Agomir/Antagomir

MicroRNA: rno-miR-671 Accession Number: MIMAT0005326 Mature Sequence UCCGGUUCUCAGGGCUCCACC rno-miR-...more +inquiry


MIRacle™ rno-miR-664-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-664-3p Accession Number: MIMAT0003382 Mature Sequence UAUUCAUUUACUCCCCAGCCUA rno-...more +inquiry


MIRacle™ rno-miR-383-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-383-3p Accession Number: MIMAT0017197 Mature Sequence CCACAGCACUGCCUGGUCAGA rno-m...more +inquiry


MIRacle™ rno-miR-203a-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-203a-3p Accession Number: MIMAT0000876 Mature Sequence GUGAAAUGUUUAGGACCACUAG rno...more +inquiry


MIRacle™ rno-miR-135a-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-135a-5p Accession Number: MIMAT0000841 Mature Sequence UAUGGCUUUUUAUUCCUAUGUGA rn...more +inquiry


MIRacle™ rno-miR-30b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30b-5p Accession Number: MIMAT0000806 Mature Sequence UGUAAACAUCCUACACUCAGCU rno-...more +inquiry


MIRacle™ rno-let-7a-5p miRNA Agomir/Antagomir

MicroRNA: rno-let-7a-5p Accession Number: MIMAT0000774 Mature Sequence UGAGGUAGUAGGUUGUAUAGUU rno-l...more +inquiry


MIRacle™ rno-miR-486 miRNA Agomir/Antagomir

MicroRNA: rno-miR-486 Accession Number: MIMAT0037265 Mature Sequence UCCUGUACUGAGCUGCCCCGAG rno-miR...more +inquiry


MIRacle™ rno-miR-6216 miRNA Agomir/Antagomir

MicroRNA: rno-miR-6216 Accession Number: MIMAT0024856 Mature Sequence GAUACACAGAGGCAGGAGGAGAA rno-m...more +inquiry


MIRacle™ rno-miR-3570 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3570 Accession Number: MIMAT0017850 Mature Sequence GGUACAAUCAACGGUCGAUGGU rno-mi...more +inquiry


MIRacle™ rno-miR-465-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-465-5p Accession Number: MIMAT0012850 Mature Sequence UAUUUAGAACGGUGCUGGUGUG rno-...more +inquiry


MIRacle™ rno-miR-598-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-598-3p Accession Number: MIMAT0005325 Mature Sequence UACGUCAUCGUCGUCAUCGUUA rno-...more +inquiry


MIRacle™ rno-miR-664-1-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-664-1-5p Accession Number: MIMAT0017228 Mature Sequence CUGGCUGGGGAAAAAGAUUGG rno...more +inquiry


MIRacle™ rno-miR-383-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-383-5p Accession Number: MIMAT0003114 Mature Sequence CAGAUCAGAAGGUGACUGUGG rno-m...more +inquiry


MIRacle™ rno-miR-203a-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-203a-5p Accession Number: MIMAT0017153 Mature Sequence AGUGGUUCUUAACAGUUCAAC rno-...more +inquiry


MIRacle™ rno-miR-134-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-134-3p Accession Number: MIMAT0017125 Mature Sequence CUGUGGGCCACCUAGUCACCAA rno-...more +inquiry


MIRacle™ rno-miR-30e-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30e-3p Accession Number: MIMAT0004720 Mature Sequence CUUUCAGUCGGAUGUUUACAGC rno-...more +inquiry
AcceGen Scroll Top Button