Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM3899

MIRacle™ mmu-miR-7680-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7680-5p Accession Number: MIMAT0029874 Mature Sequence: AUUCCAGUGAACAAGCAGUU mmu-m...more +inquiry

AM3915

MIRacle™ mmu-miR-5116 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5116 Accession Number: MIMAT0020624 Mature Sequence: UUUGAUAGGAACCCCGCCUGA mmu-miR...more +inquiry

AM3931

MIRacle™ mmu-miR-218-1-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-218-1-3p Accession Number: MIMAT0004665 Mature Sequence: AAACAUGGUUCCGUCAAGCACC mm...more +inquiry

AM3947

MIRacle™ mmu-miR-6990-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6990-3p Accession Number: MIMAT0027883 Mature Sequence: AGCCCUGCCUCUUCCUGGCAG mmu-...more +inquiry

AM3963

MIRacle™ mmu-miR-421-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-421-3p Accession Number: MIMAT0004869 Mature Sequence: AUCAACAGACAUUAAUUGGGCGC mmu...more +inquiry

AM3979

MIRacle™ mmu-miR-7681-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7681-5p Accession Number: MIMAT0029882 Mature Sequence: AUCCUGUCCUUGCCCUCUCU mmu-m...more +inquiry

AM3995

MIRacle™ mmu-miR-5123 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5123 Accession Number: MIMAT0020633 Mature Sequence: UGUAGAUCCAUAUGCCAUGGUGUG mmu-...more +inquiry

AM4011

MIRacle™ mmu-miR-26a-2-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-26a-2-3p Accession Number: MIMAT0017058 Mature Sequence: CCUGUUCUUGAUUACUUGUUUC mm...more +inquiry

AM4027

MIRacle™ mmu-miR-6994-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6994-3p Accession Number: MIMAT0027891 Mature Sequence: AACGAUCUUCUCCGUCUUUGC mmu-...more +inquiry

AM4043

MIRacle™ mmu-miR-466c-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-466c-5p Accession Number: MIMAT0004877 Mature Sequence: UGAUGUGUGUGUGCAUGUACAUAU m...more +inquiry

AM4059

MIRacle™ mmu-miR-7684-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7684-5p Accession Number: MIMAT0029890 Mature Sequence: UCUGGGAAGCCUGGGCAGCAG mmu-...more +inquiry

AM4075

MIRacle™ mmu-miR-5129-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5129-5p Accession Number: MIMAT0020640 Mature Sequence: AUGUGGGGGCAUUGGUAUUUUC mmu...more +inquiry

AM4091

MIRacle™ mmu-miR-222-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-222-3p Accession Number: MIMAT0000670 Mature Sequence: AGCUACAUCUGGCUACUGGGU mmu-m...more +inquiry

AM4107

MIRacle™ mmu-miR-6998-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6998-3p Accession Number: MIMAT0027899 Mature Sequence: AGAGCUGCUCUGUGCCCACACA mmu...more +inquiry

AM4123

MIRacle™ mmu-miR-466h-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-466h-3p Accession Number: MIMAT0017274 Mature Sequence: UACGCACGCACACACACAC mmu-mi...more +inquiry

AM4139

MIRacle™ mmu-miR-7686-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7686-5p Accession Number: MIMAT0029898 Mature Sequence: CCUUCCACUGGACCUGGGGCUGGGC ...more +inquiry

AM4155

MIRacle™ mmu-miR-5134-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5134-3p Accession Number: MIMAT0022989 Mature Sequence: ACGGGUGGCCCUCUUUCUGCAG mmu...more +inquiry

AM4171

MIRacle™ mmu-miR-92a-1-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-92a-1-5p Accession Number: MIMAT0017066 Mature Sequence: AGGUUGGGAUUUGUCGCAAUGCU m...more +inquiry

AM4187

MIRacle™ mmu-miR-7002-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7002-3p Accession Number: MIMAT0027907 Mature Sequence: UUGUGCUUCCCCUUGCCAG mmu-mi...more +inquiry

AM4203

MIRacle™ mmu-miR-504-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-504-3p Accession Number: MIMAT0017277 Mature Sequence: AGGGAGAGCAGGGCAGGGUUUC mmu-...more +inquiry
AcceGen Scroll Top Button