Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM5194

MIRacle™ rno-miR-101b-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-101b-3p Accession Number: MIMAT0000615 Mature Sequence UACAGUACUGUGAUAGCUGAA rno-...more +inquiry

AM5193

MIRacle™ rno-miR-676 miRNA Agomir/Antagomir

MicroRNA: rno-miR-676 Accession Number: MIMAT0037264 Mature Sequence CCGUCCUGAGCUUGUCGAGCUA rno-miR...more +inquiry

AM5192

MIRacle™ rno-miR-378b miRNA Agomir/Antagomir

MicroRNA: rno-miR-378b Accession Number: MIMAT0024855 Mature Sequence AGUGGACUUGGAGUCAGAAGG rno-miR...more +inquiry

AM5191

MIRacle™ rno-miR-3569 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3569 Accession Number: MIMAT0017849 Mature Sequence GGAGGACAGCAGACUCAGGUC rno-miR...more +inquiry

AM5190

MIRacle™ rno-miR-295-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-295-3p Accession Number: MIMAT0017366 Mature Sequence AAGUGCUACUACUUUUGGGUGU rno-...more +inquiry

AM5189

MIRacle™ rno-miR-598-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-598-5p Accession Number: MIMAT0005324 Mature Sequence GCGGUGAUGCCGAUGGUGCGAG rno-...more +inquiry

AM5188

MIRacle™ rno-miR-499-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-499-3p Accession Number: MIMAT0017227 Mature Sequence AACAUCACAGCAAGUCUGUGCU rno-...more +inquiry

AM5187

MIRacle™ rno-miR-489-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-489-3p Accession Number: MIMAT0003113 Mature Sequence AUGACAUCACAUAUAUGGCAGC rno-...more +inquiry

AM5186

MIRacle™ rno-miR-200b-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-200b-3p Accession Number: MIMAT0000875 Mature Sequence UAAUACUGCCUGGUAAUGAUGAC rn...more +inquiry

AM5185

MIRacle™ rno-miR-134-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-134-5p Accession Number: MIMAT0000840 Mature Sequence UGUGACUGGUUGACCAGAGGGG rno-...more +inquiry

AM5184

MIRacle™ rno-miR-30e-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30e-5p Accession Number: MIMAT0000805 Mature Sequence UGUAAACAUCCUUGACUGGAAG rno-...more +inquiry

AM5183

MIRacle™ rno-miR-101b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-101b-5p Accession Number: MIMAT0017045 Mature Sequence UCGGUUAUCAUGGUACCGAUGC rno...more +inquiry

AM5182

MIRacle™ rno-miR-1b miRNA Agomir/Antagomir

MicroRNA: rno-miR-1b Accession Number: MIMAT0037263 Mature Sequence UGGAAUGUAAAGAAGUAUGUAU rno-miR-...more +inquiry

AM5181

MIRacle™ rno-miR-6215 miRNA Agomir/Antagomir

MicroRNA: rno-miR-6215 Accession Number: MIMAT0024854 Mature Sequence UUUAGGGUUGCAGAGCCAGG rno-miR-...more +inquiry

AM5180

MIRacle™ rno-miR-3568 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3568 Accession Number: MIMAT0017848 Mature Sequence UGUUCUUCCCGUGCAGAAGCAG rno-mi...more +inquiry

AM5179

MIRacle™ rno-miR-295-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-295-5p Accession Number: MIMAT0012849 Mature Sequence ACUCAAAUGUGGGGCACACUUCU rno...more +inquiry

AM5178

MIRacle™ rno-miR-532-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-532-3p Accession Number: MIMAT0005323 Mature Sequence CCUCCCACACCCAAGGCUUGCA rno-...more +inquiry

AM5177

MIRacle™ rno-miR-499-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-499-5p Accession Number: MIMAT0003381 Mature Sequence UUAAGACUUGCAGUGAUGUUU rno-m...more +inquiry

AM5176

MIRacle™ rno-miR-489-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-489-5p Accession Number: MIMAT0017196 Mature Sequence UGUCGUAUGCGUGAUGACACGUUC rn...more +inquiry

AM5175

MIRacle™ rno-miR-200b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-200b-5p Accession Number: MIMAT0017152 Mature Sequence CAUCUUACUGGGCAGCAUUGGA rno...more +inquiry
AcceGen Scroll Top Button