Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM4575

MIRacle™ rno-miR-711 miRNA Agomir/Antagomir

MicroRNA: rno-miR-711 Accession Number: MIMAT0012859 Mature Sequence GGGACCCUGGGAGAGAUGUAAG rno-miR...more +inquiry

AM4591

MIRacle™ rno-miR-34b-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-34b-3p Accession Number: MIMAT0017105 Mature Sequence AAUCACUAACUCCACUGCCAUC rno-...more +inquiry

AM4607

MIRacle™ rno-miR-760-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-760-5p Accession Number: MIMAT0005336 Mature Sequence CCCCUCAGGCCACCAGAGCCCG rno-...more +inquiry

AM4623

MIRacle™ rno-miR-9a-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-9a-5p Accession Number: MIMAT0000781 Mature Sequence UCUUUGGUUAUCUAGCUGUAUGA rno-...more +inquiry

AM4639

MIRacle™ rno-miR-878 miRNA Agomir/Antagomir

MicroRNA: rno-miR-878 Accession Number: MIMAT0005286 Mature Sequence GCAUGACACCAUACUGGGUAGA rno-miR...more +inquiry

AM4655

MIRacle™ rno-miR-328a-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-328a-5p Accession Number: MIMAT0017029 Mature Sequence GGGGGGCAGGAGGGGCUCA rno-mi...more +inquiry

AM4671

MIRacle™ rno-miR-540-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-540-5p Accession Number: MIMAT0017211 Mature Sequence CAAGGGUCACCCUCUGACUCUGU rno...more +inquiry

AM4687

MIRacle™ rno-miR-6330 miRNA Agomir/Antagomir

MicroRNA: rno-miR-6330 Accession Number: MIMAT0025069 Mature Sequence UAUAAUGACCAGAUCUGGGUCA rno-mi...more +inquiry

AM4703

MIRacle™ rno-miR-219a-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-219a-5p Accession Number: MIMAT0000889 Mature Sequence UGAUUGUCCAAACGCAAUUCU rno-...more +inquiry

AM4719

MIRacle™ rno-miR-3584-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-3584-3p Accession Number: MIMAT0017876 Mature Sequence GCCCGCAUCUCUGGAUCCC rno-mi...more +inquiry

AM4735

MIRacle™ rno-miR-153-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-153-5p Accession Number: MIMAT0017135 Mature Sequence GUCAUUUUUGUGAUGUUGCAGCU rno...more +inquiry

AM4751

MIRacle™ rno-miR-3550 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3550 Accession Number: MIMAT0017808 Mature Sequence CCGAGCCCAUCCCUGCCCUAG rno-miR...more +inquiry

AM4767

MIRacle™ rno-miR-99b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-99b-5p Accession Number: MIMAT0000821 Mature Sequence CACCCGUAGAACCGACCUUGCG rno-...more +inquiry

AM4783

MIRacle™ rno-miR-202-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-202-5p Accession Number: MIMAT0012822 Mature Sequence UUCCUAUGCAUAUACUUCU rno-miR...more +inquiry

AM4799

MIRacle™ rno-miR-19b-2-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-19b-2-5p Accession Number: MIMAT0017097 Mature Sequence AGUUUUGCAGAUUUGCAGUUCAG r...more +inquiry

AM4815

MIRacle™ rno-miR-190b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-190b-5p Accession Number: MIMAT0005302 Mature Sequence UGAUAUGUUUGAUAUUAGGUU rno-...more +inquiry

AM4831

MIRacle™ rno-miR-148b-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-148b-3p Accession Number: MIMAT0000579 Mature Sequence UCAGUGCAUCACAGAACUUUGU rno...more +inquiry

AM4847

MIRacle™ rno-miR-376c-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-376c-5p Accession Number: MIMAT0017219 Mature Sequence GUGGAUAUUCCUUCUAUGUUU rno-...more +inquiry

AM4863

MIRacle™ rno-miR-148a-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-148a-3p Accession Number: MIMAT0035725 Mature Sequence UCAGUGCACUACAGAACUUUG rno-...more +inquiry

AM4879

MIRacle™ rno-miR-297 miRNA Agomir/Antagomir

MicroRNA: rno-miR-297 Accession Number: MIMAT0000899 Mature Sequence AUGUAUGUGUGCAUGUAUGCAUG rno-mi...more +inquiry
AcceGen Scroll Top Button