Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.


  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.# Name Description Price


MIRacle™ rno-miR-133a-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-133a-3p Accession Number: MIMAT0000839 Mature Sequence UUUGGUCCCCUUCAACCAGCUG rno...more +inquiry


MIRacle™ rno-miR-30c-1-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30c-1-3p Accession Number: MIMAT0004719 Mature Sequence CUGGGAGAGGGUUGUUUACUCC rn...more +inquiry


MIRacle™ rno-miR-151-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-151-3p Accession Number: MIMAT0000614 Mature Sequence CUAGACUGAGGCUCCUUGAGG rno-m...more +inquiry


MIRacle™ rno-miR-466b-4-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-466b-4-3p Accession Number: MIMAT0037262 Mature Sequence AUAUACAUACACACAUACACA rn...more +inquiry


MIRacle™ rno-miR-3473 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3473 Accession Number: MIMAT0024853 Mature Sequence UCUAGGGCUGGAGAGAUGGCUA rno-mi...more +inquiry


MIRacle™ rno-miR-216b-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-216b-3p Accession Number: MIMAT0017847 Mature Sequence CACACUUACUUGUAGAGAUU rno-m...more +inquiry


MIRacle™ rno-miR-294 miRNA Agomir/Antagomir

MicroRNA: rno-miR-294 Accession Number: MIMAT0012848 Mature Sequence CUCAAAAUGGAGGCCCUAUCU rno-miR-...more +inquiry


MIRacle™ rno-miR-532-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-532-5p Accession Number: MIMAT0005322 Mature Sequence CAUGCCUUGAGUGUAGGACUGU rno-...more +inquiry


MIRacle™ rno-miR-505-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-505-3p Accession Number: MIMAT0003380 Mature Sequence GUCAACACUUGCUGGUUUCC rno-mi...more +inquiry


MIRacle™ rno-miR-451-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-451-3p Accession Number: MIMAT0017193 Mature Sequence AUGGUAAUGGUUCUCUUGCUGCU rno...more +inquiry


MIRacle™ rno-miR-200a-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-200a-3p Accession Number: MIMAT0000874 Mature Sequence UAACACUGUCUGGUAACGAUGU rno...more +inquiry


MIRacle™ rno-miR-133a-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-133a-5p Accession Number: MIMAT0017124 Mature Sequence AGCUGGUAAAAUGGAACCAAAU rno...more +inquiry


MIRacle™ rno-miR-30c-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30c-5p Accession Number: MIMAT0000804 Mature Sequence UGUAAACAUCCUACACUCUCAGC rno...more +inquiry


MIRacle™ rno-miR-151-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-151-5p Accession Number: MIMAT0000613 Mature Sequence UCGAGGAGCUCACAGUCUAGU rno-m...more +inquiry


MIRacle™ rno-miR-762 miRNA Agomir/Antagomir

MicroRNA: rno-miR-762 Accession Number: MIMAT0035752 Mature Sequence GCGGGGCUAGGGCCGGGA rno-miR-762...more +inquiry


MIRacle™ rno-miR-1306-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-1306-3p Accession Number: MIMAT0024852 Mature Sequence GACGUUGGCUCUGGUGGUGAUG rno...more +inquiry


MIRacle™ rno-miR-216b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-216b-5p Accession Number: MIMAT0017846 Mature Sequence AAAUCUCUGCAGGCAAAUGUGA rno...more +inquiry


MIRacle™ rno-miR-293-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-293-3p Accession Number: MIMAT0017365 Mature Sequence AGUGCCGCAAAGUUUGCAGUGU rno-...more +inquiry


MIRacle™ rno-miR-500-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-500-3p Accession Number: MIMAT0005321 Mature Sequence AAUGCACCUGGGCAAGGGUUCA rno-...more +inquiry


MIRacle™ rno-miR-505-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-505-5p Accession Number: MIMAT0017226 Mature Sequence GGGAGCCAGGAAGUAUUGAUGUU rno...more +inquiry
AcceGen Scroll Top Button