Home > Products > Rat MicroRNA Agomir/Antagomir >
Rat MicroRNA Agomir/Antagomir
Rat MicroRNAs (rno-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes, which are involved in the regulation of post-transcriptional gene expression in the rat. Rat MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the rat endogenous miRNA to regulate the biological function of the target gene. Rat MicroRNA Antagomir is an especially chemically modified miRNA antagonist.
Rat miRNA Agomir/Antagomir has higher stability/inhibitory effects in vivo and in vitro, and can overcome obstacles such as cell membranes and tissues in the body to enrich for target cells. In animal experiments, it can be administered by systemic or local injection, inhalation, feeding, etc. The effect can last for several weeks.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Rat MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM4494 | MIRacle™ rno-miR-206-3p miRNA Agomir/Antagomir | MicroRNA: rno-miR-206-3p Accession Number: MIMAT0000879 Mature Sequence UGGAAUGUAAGGAAGUGUGUGG rno-...more | +inquiry | |
| AM4493 | MIRacle™ rno-miR-137-3p miRNA Agomir/Antagomir | MicroRNA: rno-miR-137-3p Accession Number: MIMAT0000843 Mature Sequence UUAUUGCUUAAGAAUACGCGUAG rno...more | +inquiry | |
| AM4492 | MIRacle™ rno-miR-30a-3p miRNA Agomir/Antagomir | MicroRNA: rno-miR-30a-3p Accession Number: MIMAT0000809 Mature Sequence CUUUCAGUCGGAUGUUUGCAGC rno-...more | +inquiry | |
| AM4491 | MIRacle™ rno-let-7c-5p miRNA Agomir/Antagomir | MicroRNA: rno-let-7c-5p Accession Number: MIMAT0000776 Mature Sequence UGAGGUAGUAGGUUGUAUGGUU rno-l...more | +inquiry | |
| AM4490 | MIRacle™ rno-miR-322-5p miRNA Agomir/Antagomir | MicroRNA: rno-miR-322-5p Accession Number: MIMAT0001619 Mature Sequence CAGCAGCAAUUCAUGUUUUGGA rno-...more | +inquiry |
