Home > Products > MicroRNA Agomir/Antagomir >
MicroRNA Agomir/Antagomir
MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.
MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.
MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
Click on the selected item to view the products:
Cat.# | Name | Description | Stock | Price |
---|---|---|---|---|
AM0055 | MIRacle™ hsa-miR-522-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-522-3p Accession Number: MIMAT0002868 Mature Sequence: AAAAUGGUUCCCUUUAGAGUGU hsa-...more | +inquiry | |
AM0054 | MIRacle™ hsa-miR-409-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-409-3p Accession Number: MIMAT0001639 Mature Sequence: GAAUGUUGCUCGGUGAACCCCU hsa-...more | +inquiry | |
AM0053 | MIRacle™ hsa-miR-302c-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-302c-5p Accession Number: MIMAT0000716 Mature Sequence: UUUAACAUGGGGGUACCUGCUG hsa...more | +inquiry | |
AM0052 | MIRacle™ hsa-miR-142-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-142-5p Accession Number: MIMAT0000433 Mature Sequence: CAUAAAGUAGAAAGCACUACU hsa-m...more | +inquiry | |
AM0051 | MIRacle™ hsa-miR-30d-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-30d-5p Accession Number: MIMAT0000245 Mature Sequence: UGUAAACAUCCCCGACUGGAAG hsa-...more | +inquiry | |
AM0050 | MIRacle™ hsa-miR-7158-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7158-5p Accession Number: MIMAT0028226 Mature Sequence: GGCUCAAUCUCUGGUCCUGCAGCC h...more | +inquiry | |
AM0049 | MIRacle™ hsa-miR-6862-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6862-5p Accession Number: MIMAT0027625 Mature Sequence: CGGGCAUGCUGGGAGAGACUUU hsa...more | +inquiry | |
AM0048 | MIRacle™ hsa-miR-6812-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6812-3p Accession Number: MIMAT0027525 Mature Sequence: CCGCUCUUCCCCUGACCCCAG hsa-...more | +inquiry | |
AM0047 | MIRacle™ hsa-miR-6762-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6762-3p Accession Number: MIMAT0027425 Mature Sequence: UGGCUGCUUCCCUUGGUCUCCAG hs...more | +inquiry | |
AM0046 | MIRacle™ hsa-miR-6511a-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6511a-3p Accession Number: MIMAT0025479 Mature Sequence: CCUCACCAUCCCUUCUGCCUGC hs...more | +inquiry | |
AM0045 | MIRacle™ hsa-miR-5683 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5683 Accession Number: MIMAT0022472 Mature Sequence: UACAGAUGCAGAUUCUCUGACUUC hsa-...more | +inquiry | |
AM0044 | MIRacle™ hsa-miR-548ao-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-548ao-3p Accession Number: MIMAT0021030 Mature Sequence: AAAGACCGUGACUACUUUUGCA hs...more | +inquiry | |
AM0043 | MIRacle™ hsa-miR-4756-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4756-5p Accession Number: MIMAT0019899 Mature Sequence: CAGGGAGGCGCUCACUCUCUGCU hs...more | +inquiry | |
AM0042 | MIRacle™ hsa-miR-4704-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4704-5p Accession Number: MIMAT0019803 Mature Sequence: GACACUAGGCAUGUGAGUGAUU hsa...more | +inquiry | |
AM0041 | MIRacle™ hsa-miR-4643 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4643 Accession Number: MIMAT0019703 Mature Sequence: GACACAUGACCAUAAAUGCUAA hsa-mi...more | +inquiry | |
AM0040 | MIRacle™ hsa-miR-4480 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4480 Accession Number: MIMAT0019014 Mature Sequence: AGCCAAGUGGAAGUUACUUUA hsa-miR...more | +inquiry | |
AM0039 | MIRacle™ hsa-miR-642b-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-642b-5p Accession Number: MIMAT0022736 Mature Sequence: GGUUCCCUCUCCAAAUGUGUCU hsa...more | +inquiry | |
AM0038 | MIRacle™ hsa-miR-3661 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3661 Accession Number: MIMAT0018082 Mature Sequence: UGACCUGGGACUCGGACAGCUG hsa-mi...more | +inquiry | |
AM0037 | MIRacle™ hsa-miR-4323 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4323 Accession Number: MIMAT0016875 Mature Sequence: CAGCCCCACAGCCUCAGA hsa-miR-43...more | +inquiry | |
AM0036 | MIRacle™ hsa-miR-3160-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3160-5p Accession Number: MIMAT0019212 Mature Sequence: GGCUUUCUAGUCUCAGCUCUCC hsa...more | +inquiry |