Home > Products > Human MicroRNA Agomir/Antagomir >

MIRacle™ hsa-miR-224-5p miRNA Agomir/Antagomir

Product Name

MIRacle™ hsa-miR-224-5p miRNA Agomir/Antagomir

Price Get Quote
Cat.No

AM1600

Species

Human

Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Description

MicroRNA: hsa-miR-224-5p

Accession Number: MIMAT0000281
Mature Sequence: CAAGUCACUAGUGGUUCCGUU

 

hsa-miR-224-5p is a microRNA that has been implicated in several types of cancer, including hepatocellular carcinoma (HCC), pancreatic mucinous cystadenocarcinoma (MCC), and clear cell renal cell carcinoma (ccRCC).

 

In HCC, hsa-miR-224-5p is consistently upregulated in tumor tissues and blood samples, suggesting its potential as a diagnostic marker. Furthermore, its expression level has been correlated with the survival rate of HCC patients, indicating its prognostic significance. Similarly, in the context of hepatocellular carcinoma, hsa-miR-224-5p has been identified as an upregulated molecule in tumor samples. It targets several mRNA molecules, including NR4A3, FHL2, and NKX3-1, which may play a role in HCC tumorigenesis. In MCC, hsa-miR-224-5p is highly expressed and serves as an oncogene. It regulates the proliferation, migration, and invasion of pancreatic MCC cells and shows potential as a therapeutic target for MCC treatment. Furthermore, in ccRCC, miR-224-5p promotes cell proliferation, migration, and invasion by downregulating OCLN, contributing to the pathogenesis of the disease. Additionally, miR-224-5p deficiency leads to the upregulation of Pentraxin 3 (PTX3), which activates the p65/NF-κB pathway, promoting M1 macrophage polarization by targeting CD32.

 

Click here to browse detailed information about hsa-miR-224-5p in miRBase.

 

Introduction and Application of hsa-miR-224-5p miRNA Agomir/Antagomir

hsa-miR-224-5p Agomir can be utilized to investigate the role and mechanism of miR-224-5p in cancer cell proliferation, migration, and invasion. By mimicking the endogenous miRNA, Agomir regulates the biological function of target genes, providing insights into the molecular mechanisms underlying carcinoma. hsa-miR-224-5p may serve as a potential target for therapeutic interventions, offering a promising treatment strategy.

 

On the other hand, hsa-miR-224-5p Antagomir acts as a chemically modified miRNA antagonist, competing strongly with mature miRNAs in the body. This prevents the complementary pairing of miRNAs with their target genes, effectively inhibiting the functioning of miRNAs.

 

Why choose hsa-miR-224-5p miRNA Agomir/Antagomir from AcceGen?

AcceGen offers hsa-miR-224-5p miRNA Agomir/Antagomir with extended stability, lasting up to 5-6 weeks. Their expertise covers a comprehensive range of human, mouse, and rat miRNAs from miRBase. These products are ideal for in vitro and in vivo miRNA functional studies, providing a reliable tool to investigate the function and mechanism of hsa-miR-224-5p in various biological processes and potential therapeutic applications.

Recommended Medium And Supplement
Citation Guide

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Label

FAM, CY3, CY5, etc. (optional)

Application

For research use only

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Component

hsa-miR-224-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Product Type

microRNA Agomir/Antagomir

Product Image AcceGen Frozen Cells & Cell Lines AcceGen Frozen Cells & Cell Lines
Tech Document

MIRacle™ Agomir Product Manual

MIRacle™ Antagomir Product Manual

MSDS-AcceGen MicroRNA Agomir

MSDS-AcceGen MicroRNA Antagomir

  • ONLINE INQUIRY
  • PRODUCT REVIEWS
We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time?

Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
Privacy Policy: AcceGen will never sell, rent, or share your personal information with any third parties without your express permission.
Reviews of MIRacle™ hsa-miR-224-5p miRNA Agomir/Antagomir
AcceGen is always trying to do right by our customers and working hard to build a higher quality product.

Your email address will not be published.

AcceGen Scroll Top Button
Copy link
Powered by Social Snap