Home > Products > Human MicroRNA Agomir/Antagomir >

Human MicroRNA Agomir/Antagomir

AcceGen Human MicroRNA Agomir/Antagomir

Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.

Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM2574

MIRacle™ hsa-miR-7157-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-7157-5p Accession Number: MIMAT0028224 Mature Sequence: UCAGCAUUCAUUGGCACCAGAGA hs...more +inquiry

AM2573

MIRacle™ hsa-miR-6861-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6861-5p Accession Number: MIMAT0027623 Mature Sequence: ACUGGGUAGGUGGGGCUCCAGG hsa...more +inquiry

AM2572

MIRacle™ hsa-miR-6811-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6811-3p Accession Number: MIMAT0027523 Mature Sequence: AGCCUGUGCUUGUCCCUGCAG hsa-...more +inquiry

AM2571

MIRacle™ hsa-miR-6761-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6761-3p Accession Number: MIMAT0027423 Mature Sequence: UCCUACGCUGCUCUCUCACUCC hsa...more +inquiry

AM2570

MIRacle™ hsa-miR-6510-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6510-3p Accession Number: MIMAT0025477 Mature Sequence: CACCGACUCUGUCUCCUGCAG hsa-...more +inquiry

AM2569

MIRacle™ hsa-miR-5682 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5682 Accession Number: MIMAT0022470 Mature Sequence: GUAGCACCUUGCAGGAUAAGGU hsa-mi...more +inquiry

AM2568

MIRacle™ hsa-miR-5004-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5004-3p Accession Number: MIMAT0021028 Mature Sequence: CUUGGAUUUUCCUGGGCCUCAG hsa...more +inquiry

AM2567

MIRacle™ hsa-miR-499b-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-499b-5p Accession Number: MIMAT0019897 Mature Sequence: ACAGACUUGCUGUGAUGUUCA hsa-...more +inquiry

AM2566

MIRacle™ hsa-miR-4703-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4703-5p Accession Number: MIMAT0019801 Mature Sequence: UAGCAAUACAGUACAAAUAUAGU hs...more +inquiry

AM2565

MIRacle™ hsa-miR-4641 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4641 Accession Number: MIMAT0019701 Mature Sequence: UGCCCAUGCCAUACUUUUGCCUCA hsa-...more +inquiry

AM2564

MIRacle™ hsa-miR-3155b miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3155b Accession Number: MIMAT0019012 Mature Sequence: CCAGGCUCUGCAGUGGGA hsa-miR-3...more +inquiry

AM2563

MIRacle™ hsa-miR-374c-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-374c-5p Accession Number: MIMAT0018443 Mature Sequence: AUAAUACAACCUGCUAAGUGCU hsa...more +inquiry

AM2562

MIRacle™ hsa-miR-3659 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3659 Accession Number: MIMAT0018080 Mature Sequence: UGAGUGUUGUCUACGAGGGCA hsa-miR...more +inquiry

AM2561

MIRacle™ hsa-miR-4322 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4322 Accession Number: MIMAT0016873 Mature Sequence: CUGUGGGCUCAGCGCGUGGGG hsa-miR...more +inquiry

AM2560

MIRacle™ hsa-miR-3158-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3158-3p Accession Number: MIMAT0015032 Mature Sequence: AAGGGCUUCCUCUCUGCAGGAC hsa...more +inquiry

AM2559

MIRacle™ hsa-miR-1972 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1972 Accession Number: MIMAT0009447 Mature Sequence: UCAGGCCAGGCACAGUGGCUCA hsa-mi...more +inquiry

AM2558

MIRacle™ hsa-miR-548f-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-548f-5p Accession Number: MIMAT0026739 Mature Sequence: UGCAAAAGUAAUCACAGUUUUU hsa...more +inquiry

AM2557

MIRacle™ hsa-miR-887-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-887-5p Accession Number: MIMAT0026720 Mature Sequence: CUUGGGAGCCCUGUUAGACUC hsa-m...more +inquiry

AM2556

MIRacle™ hsa-miR-411-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-411-3p Accession Number: MIMAT0004813 Mature Sequence: UAUGUAACACGGUCCACUAACC hsa-...more +inquiry

AM2555

MIRacle™ hsa-miR-548b-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-548b-5p Accession Number: MIMAT0004798 Mature Sequence: AAAAGUAAUUGUGGUUUUGGCC hsa...more +inquiry
AcceGen Scroll Top Button