Dear AcceGen Customers,

Recently, we found some defrauding emails was trying to impersonate us and send out overdue invoice payment notice. Please check carefully and do not send money to any unverified bank account. If you are unable to identify the mail, please contact us at info@accegen.com directly to avoid any losses. Your personal information security is always important to us. Thank you.

X

Home > Products > Human MicroRNA Agomir/Antagomir >

Human MicroRNA Agomir/Antagomir

AcceGen Human MicroRNA Agomir/Antagomir

Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.

Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM0547

MIRacle™ hsa-miR-548ac miRNA Agomir/Antagomir

MicroRNA: hsa-miR-548ac Accession Number: MIMAT0018938 Mature Sequence: CAAAAACCGGCAAUUACUUUUG hsa-m...more +inquiry

AM0563

MIRacle™ hsa-miR-490-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-490-5p Accession Number: MIMAT0004764 Mature Sequence: CCAUGGAUCUCCAGGUGGGU hsa-mi...more +inquiry

AM0579

MIRacle™ hsa-miR-5700 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5700 Accession Number: MIMAT0022493 Mature Sequence: UAAUGCAUUAAAUUAUUGAAGG hsa-mi...more +inquiry

AM0595

MIRacle™ hsa-miR-711 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-711 Accession Number: MIMAT0012734 Mature Sequence: GGGACCCAGGGAGAGACGUAAG hsa-miR...more +inquiry

AM0611

MIRacle™ hsa-miR-19b-1-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-19b-1-5p Accession Number: MIMAT0004491 Mature Sequence: AGUUUUGCAGGUUUGCAUCCAGC h...more +inquiry

AM0627

MIRacle™ hsa-miR-4659a-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4659a-5p Accession Number: MIMAT0019726 Mature Sequence: CUGCCAUGUCUAAGAAGAAAAC hs...more +inquiry

AM0643

MIRacle™ hsa-miR-605-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-605-5p Accession Number: MIMAT0003273 Mature Sequence: UAAAUCCCAUGGUGCCUUCUCCU hsa...more +inquiry

AM0659

MIRacle™ hsa-miR-6774-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6774-3p Accession Number: MIMAT0027449 Mature Sequence: UCGUGUCCCUCUUGUCCACAG hsa-...more +inquiry

AM0675

MIRacle™ hsa-miR-4264 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4264 Accession Number: MIMAT0016899 Mature Sequence: ACUCAGUCAUGGUCAUU hsa-miR-426...more +inquiry

AM0691

MIRacle™ hsa-miR-134-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-134-3p Accession Number: MIMAT0026481 Mature Sequence: CCUGUGGGCCACCUAGUCACCAA hsa...more +inquiry

AM0707

MIRacle™ hsa-miR-4771 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4771 Accession Number: MIMAT0019925 Mature Sequence: AGCAGACUUGACCUACAAUUA hsa-miR...more +inquiry

AM0723

MIRacle™ hsa-miR-940 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-940 Accession Number: MIMAT0004983 Mature Sequence: AAGGCAGGGCCCCCGCUCCCC hsa-miR-...more +inquiry

AM0739

MIRacle™ hsa-miR-6876-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6876-5p Accession Number: MIMAT0027652 Mature Sequence: CAGGAAGGAGACAGGCAGUUCA hsa...more +inquiry

AM0755

MIRacle™ hsa-miR-548ad-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-548ad-5p Accession Number: MIMAT0032114 Mature Sequence: AAAAGUAAUUGUGGUUUUUG hsa-...more +inquiry

AM0771

MIRacle™ hsa-miR-202-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-202-5p Accession Number: MIMAT0002810 Mature Sequence: UUCCUAUGCAUAUACUUCUUUG hsa-...more +inquiry

AM0787

MIRacle™ hsa-miR-5707 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5707 Accession Number: MIMAT0022501 Mature Sequence: ACGUUUGAAUGCUGUACAAGGC hsa-mi...more +inquiry

AM0803

MIRacle™ hsa-miR-3118 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3118 Accession Number: MIMAT0014980 Mature Sequence: UGUGACUGCAUUAUGAAAAUUCU hsa-m...more +inquiry

AM0819

MIRacle™ hsa-miR-22-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-22-3p Accession Number: MIMAT0000077 Mature Sequence: AAGCUGCCAGUUGAAGAACUGU hsa-m...more +inquiry

AM0835

MIRacle™ hsa-miR-4659b-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4659b-3p Accession Number: MIMAT0019734 Mature Sequence: UUUCUUCUUAGACAUGGCAGCU hs...more +inquiry

AM0851

MIRacle™ hsa-miR-612 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-612 Accession Number: MIMAT0003280 Mature Sequence: GCUGGGCAGGGCUUCUGAGCUCCUU hsa-...more +inquiry
AcceGen Scroll Top Button