Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir

Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
Cat.# | Name | Description | Price |
---|---|---|---|
AM0195 | MIRacle™ hsa-miR-5688 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5688 Accession Number: MIMAT0022479 Mature Sequence: UAACAAACACCUGUAAAACAGC hsa-mi...more | +inquiry |
AM0211 | MIRacle™ hsa-miR-3165 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3165 Accession Number: MIMAT0015039 Mature Sequence: AGGUGGAUGCAAUGUGACCUCA hsa-mi...more | +inquiry |
AM0227 | MIRacle™ hsa-miR-145-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-145-3p Accession Number: MIMAT0004601 Mature Sequence: GGAUUCCUGGAAAUACUGUUCU hsa-...more | +inquiry |
AM0243 | MIRacle™ hsa-miR-4760-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4760-3p Accession Number: MIMAT0019907 Mature Sequence: AAAUUCAUGUUCAAUCUAAACC hsa...more | +inquiry |
AM0259 | MIRacle™ hsa-miR-1250-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1250-3p Accession Number: MIMAT0026740 Mature Sequence: ACAUUUUCCAGCCCAUUCA hsa-mi...more | +inquiry |
AM0275 | MIRacle™ hsa-miR-7162-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7162-3p Accession Number: MIMAT0028235 Mature Sequence: UCUGAGGUGGAACAGCAGC hsa-mi...more | +inquiry |
AM0291 | MIRacle™ hsa-miR-4650-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4650-5p Accession Number: MIMAT0019713 Mature Sequence: UCAGGCCUCUUUCUACCUU hsa-mi...more | +inquiry |
AM0307 | MIRacle™ hsa-miR-660-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-660-3p Accession Number: MIMAT0022711 Mature Sequence: ACCUCCUGUGUGCAUGGAUUA hsa-m...more | +inquiry |
AM0323 | MIRacle™ hsa-miR-6818-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6818-5p Accession Number: MIMAT0027536 Mature Sequence: UUGUGUGAGUACAGAGAGCAUC hsa...more | +inquiry |
AM0339 | MIRacle™ hsa-miR-4419a miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4419a Accession Number: MIMAT0018931 Mature Sequence: UGAGGGAGGAGACUGCA hsa-miR-44...more | +inquiry |
AM0355 | MIRacle™ hsa-miR-486-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-486-5p Accession Number: MIMAT0002177 Mature Sequence: UCCUGUACUGAGCUGCCCCGAG hsa-...more | +inquiry |
AM0371 | MIRacle™ hsa-miR-5693 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5693 Accession Number: MIMAT0022486 Mature Sequence: GCAGUGGCUCUGAAAUGAACUC hsa-mi...more | +inquiry |
AM0387 | MIRacle™ hsa-miR-2276-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-2276-3p Accession Number: MIMAT0011775 Mature Sequence: UCUGCAAGUGUCAGAGGCGAGG hsa...more | +inquiry |
AM0403 | MIRacle™ hsa-miR-16-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-16-5p Accession Number: MIMAT0000069 Mature Sequence: UAGCAGCACGUAAAUAUUGGCG hsa-m...more | +inquiry |
AM0419 | MIRacle™ hsa-miR-4653-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4653-5p Accession Number: MIMAT0019718 Mature Sequence: UCUCUGAGCAAGGCUUAACACC hsa...more | +inquiry |
AM0435 | MIRacle™ hsa-miR-598-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-598-3p Accession Number: MIMAT0003266 Mature Sequence: UACGUCAUCGUUGUCAUCGUCA hsa-...more | +inquiry |
AM0451 | MIRacle™ hsa-miR-6770-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6770-3p Accession Number: MIMAT0027441 Mature Sequence: CUGGCGGCUGUGUCUUCACAG hsa-...more | +inquiry |
AM0467 | MIRacle™ hsa-miR-4266 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4266 Accession Number: MIMAT0016892 Mature Sequence: CUAGGAGGCCUUGGCC hsa-miR-4266...more | +inquiry |
AM0483 | MIRacle™ hsa-miR-125a-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-125a-3p Accession Number: MIMAT0004602 Mature Sequence: ACAGGUGAGGUUCUUGGGAGCC hsa...more | +inquiry |
AM0499 | MIRacle™ hsa-miR-4766-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4766-5p Accession Number: MIMAT0019917 Mature Sequence: UCUGAAAGAGCAGUUGGUGUU hsa-...more | +inquiry |