Home > Products > Human MicroRNA Agomir/Antagomir >

Human MicroRNA Agomir/Antagomir

AcceGen Human MicroRNA Agomir/Antagomir

Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.

Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM0187

MIRacle™ hsa-miR-4260 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4260 Accession Number: MIMAT0016881 Mature Sequence: CUUGGGGCAUGGAGUCCCA hsa-miR-4...more +inquiry

AM0203

MIRacle™ hsa-miR-376c-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-376c-5p Accession Number: MIMAT0022861 Mature Sequence: GGUGGAUAUUCCUUCUAUGUU hsa-...more +inquiry

AM0219

MIRacle™ hsa-miR-5008-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5008-5p Accession Number: MIMAT0021039 Mature Sequence: UGAGGCCCUUGGGGCACAGUGG hsa...more +inquiry

AM0235

MIRacle™ hsa-miR-2115-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-2115-3p Accession Number: MIMAT0011159 Mature Sequence: CAUCAGAAUUCAUGGAGGCUAG hsa...more +inquiry

AM0251

MIRacle™ hsa-miR-10a-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-10a-5p Accession Number: MIMAT0000253 Mature Sequence: UACCCUGUAGAUCCGAAUUUGUG hsa...more +inquiry

AM0267

MIRacle™ hsa-miR-4709-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4709-3p Accession Number: MIMAT0019812 Mature Sequence: UUGAAGAGGAGGUGCUCUGUAGC hs...more +inquiry

AM0283

MIRacle™ hsa-miR-216b-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-216b-3p Accession Number: MIMAT0026721 Mature Sequence: ACACACUUACCCGUAGAGAUUCUA h...more +inquiry

AM0299

MIRacle™ hsa-miR-6867-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6867-3p Accession Number: MIMAT0027635 Mature Sequence: CUCUCCCUCUUUACCCACUAG hsa-...more +inquiry

AM0315

MIRacle™ hsa-miR-4489 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4489 Accession Number: MIMAT0019023 Mature Sequence: UGGGGCUAGUGAUGCAGGACG hsa-miR...more +inquiry

AM0331

MIRacle™ hsa-miR-596 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-596 Accession Number: MIMAT0003264 Mature Sequence: AAGCCUGCCCGGCUCCUCGGG hsa-miR-...more +inquiry

AM0347

MIRacle™ hsa-miR-6768-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6768-3p Accession Number: MIMAT0027437 Mature Sequence: CAAAGGCCACAUUCUCCUGUGCAC h...more +inquiry

AM0363

MIRacle™ hsa-miR-4326 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4326 Accession Number: MIMAT0016888 Mature Sequence: UGUUCCUCUGUCUCCCAGAC hsa-miR-...more +inquiry

AM0379

MIRacle™ hsa-miR-191-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-191-3p Accession Number: MIMAT0001618 Mature Sequence: GCUGCGCUUGGAUUUCGUCCCC hsa-...more +inquiry

AM0395

MIRacle™ hsa-miR-4763-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4763-3p Accession Number: MIMAT0019913 Mature Sequence: AGGCAGGGGCUGGUGCUGGGCGGG h...more +inquiry

AM0411

MIRacle™ hsa-miR-922 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-922 Accession Number: MIMAT0004972 Mature Sequence: GCAGCAGAGAAUAGGACUACGUC hsa-mi...more +inquiry

AM0427

MIRacle™ hsa-miR-6870-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6870-5p Accession Number: MIMAT0027640 Mature Sequence: UGGGGGAGAUGGGGGUUGA hsa-mi...more +inquiry

AM0443

MIRacle™ hsa-miR-4422 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4422 Accession Number: MIMAT0018935 Mature Sequence: AAAAGCAUCAGGAAGUACCCA hsa-miR...more +inquiry

AM0459

MIRacle™ hsa-miR-488-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-488-5p Accession Number: MIMAT0002804 Mature Sequence: CCCAGAUAAUGGCACUCUCAA hsa-m...more +inquiry

AM0475

MIRacle™ hsa-miR-5697 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5697 Accession Number: MIMAT0022490 Mature Sequence: UCAAGUAGUUUCAUGAUAAAGG hsa-mi...more +inquiry

AM0491

MIRacle™ hsa-miR-2681-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-2681-5p Accession Number: MIMAT0013515 Mature Sequence: GUUUUACCACCUCCAGGAGACU hsa...more +inquiry
AcceGen Scroll Top Button