Home > Products > Human MicroRNA Agomir/Antagomir >

Human MicroRNA Agomir/Antagomir

AcceGen Human MicroRNA Agomir/Antagomir

Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.

Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM0199

MIRacle™ hsa-miR-6865-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6865-3p Accession Number: MIMAT0027631 Mature Sequence: ACACCCUCUUUCCCUACCGCC hsa-...more +inquiry

AM0215

MIRacle™ hsa-miR-4485-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4485-3p Accession Number: MIMAT0019019 Mature Sequence: UAACGGCCGCGGUACCCUAA hsa-m...more +inquiry

AM0231

MIRacle™ hsa-miR-592 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-592 Accession Number: MIMAT0003260 Mature Sequence: UUGUGUCAAUAUGCGAUGAUGU hsa-miR...more +inquiry

AM0247

MIRacle™ hsa-miR-6766-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6766-3p Accession Number: MIMAT0027433 Mature Sequence: UGAUUGUCUUCCCCCACCCUCA hsa...more +inquiry

AM0263

MIRacle™ hsa-miR-3667-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3667-3p Accession Number: MIMAT0018090 Mature Sequence: ACCUUCCUCUCCAUGGGUCUUU hsa...more +inquiry

AM0279

MIRacle™ hsa-miR-484 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-484 Accession Number: MIMAT0002174 Mature Sequence: UCAGGCUCAGUCCCCUCCCGAU hsa-miR...more +inquiry

AM0295

MIRacle™ hsa-miR-5691 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5691 Accession Number: MIMAT0022483 Mature Sequence: UUGCUCUGAGCUCCGAGAAAGC hsa-mi...more +inquiry

AM0311

MIRacle™ hsa-miR-3168 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3168 Accession Number: MIMAT0015043 Mature Sequence: GAGUUCUACAGUCAGAC hsa-miR-316...more +inquiry

AM0327

MIRacle™ hsa-miR-153-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-153-5p Accession Number: MIMAT0026480 Mature Sequence: UCAUUUUUGUGAUGUUGCAGCU hsa-...more +inquiry

AM0343

MIRacle™ hsa-miR-4762-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4762-3p Accession Number: MIMAT0019911 Mature Sequence: CUUCUGAUCAAGAUUUGUGGUG hsa...more +inquiry

AM0359

MIRacle™ hsa-miR-920 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-920 Accession Number: MIMAT0004970 Mature Sequence: GGGGAGCUGUGGAAGCAGUA hsa-miR-9...more +inquiry

AM0375

MIRacle™ hsa-miR-6869-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6869-5p Accession Number: MIMAT0027638 Mature Sequence: GUGAGUAGUGGCGCGCGGCGGC hsa...more +inquiry

AM0391

MIRacle™ hsa-miR-4420 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4420 Accession Number: MIMAT0018933 Mature Sequence: GUCACUGAUGUCUGUAGCUGAG hsa-mi...more +inquiry

AM0407

MIRacle™ hsa-miR-487a-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-487a-5p Accession Number: MIMAT0026559 Mature Sequence: GUGGUUAUCCCUGCUGUGUUCG hsa...more +inquiry

AM0423

MIRacle™ hsa-miR-5695 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5695 Accession Number: MIMAT0022488 Mature Sequence: ACUCCAAGAAGAAUCUAGACAG hsa-mi...more +inquiry

AM0439

MIRacle™ hsa-miR-2277-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-2277-3p Accession Number: MIMAT0011777 Mature Sequence: UGACAGCGCCCUGCCUGGCUC hsa-...more +inquiry

AM0455

MIRacle™ hsa-miR-17-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-17-5p Accession Number: MIMAT0000070 Mature Sequence: CAAAGUGCUUACAGUGCAGGUAG hsa-...more +inquiry

AM0471

MIRacle™ hsa-miR-4654 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4654 Accession Number: MIMAT0019720 Mature Sequence: UGUGGGAUCUGGAGGCAUCUGG hsa-mi...more +inquiry

AM0487

MIRacle™ hsa-miR-548a-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-548a-5p Accession Number: MIMAT0004803 Mature Sequence: AAAAGUAAUUGCGAGUUUUACC hsa...more +inquiry

AM0503

MIRacle™ hsa-miR-6771-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6771-3p Accession Number: MIMAT0027443 Mature Sequence: CAAACCCCUGUCUACCCGCAG hsa-...more +inquiry
AcceGen Scroll Top Button