Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM5251

MIRacle™ rno-miR-673-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-673-3p Accession Number: MIMAT0017313 Mature Sequence UCCGGGACUGAGUUCUGUGCAC rno-...more +inquiry

AM3299

MIRacle™ mmu-miR-7654-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7654-5p Accession Number: MIMAT0029814 Mature Sequence: GGAGUCGCGCUCCCGCUCGCGC mmu...more +inquiry

AM3315

MIRacle™ mmu-miR-3105-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3105-5p Accession Number: MIMAT0014941 Mature Sequence: AGAGCAAGCCCGUAAGCAGCGU mmu...more +inquiry

AM3331

MIRacle™ mmu-miR-331-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-331-3p Accession Number: MIMAT0000571 Mature Sequence: GCCCCUGGGCCUAUCCUAGAA mmu-m...more +inquiry

AM3347

MIRacle™ mmu-miR-6961-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6961-3p Accession Number: MIMAT0027823 Mature Sequence: UCCUCUUUCUUCCUGGCUCUAG mmu...more +inquiry

AM3363

MIRacle™ mmu-miR-501-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-501-5p Accession Number: MIMAT0003508 Mature Sequence: AAUCCUUUGUCCCUGGGUGAAA mmu-...more +inquiry

AM3379

MIRacle™ mmu-miR-7658-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7658-5p Accession Number: MIMAT0029822 Mature Sequence: UGUGGGCGUGGCGGUGCUGG mmu-m...more +inquiry

AM3395

MIRacle™ mmu-miR-3109-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3109-3p Accession Number: MIMAT0014950 Mature Sequence: UAGGGCCAUCUCAUCCAGAUA mmu-...more +inquiry

AM3411

MIRacle™ mmu-miR-339-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-339-3p Accession Number: MIMAT0004649 Mature Sequence: UGAGCGCCUCGGCGACAGAGCCG mmu...more +inquiry

AM3427

MIRacle™ mmu-miR-6965-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6965-3p Accession Number: MIMAT0027831 Mature Sequence: UCUGUGCUCGGUCUCGCUCCAG mmu...more +inquiry

AM3443

MIRacle™ mmu-miR-721 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-721 Accession Number: MIMAT0003515 Mature Sequence: CAGUGCAAUUAAAAGGGGGAA mmu-miR-...more +inquiry

AM3459

MIRacle™ mmu-miR-7662-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7662-5p Accession Number: MIMAT0029830 Mature Sequence: AGGGCUGAGGCCUGGAUCCAGC mmu...more +inquiry

AM3475

MIRacle™ mmu-miR-1912-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1912-3p Accession Number: MIMAT0014958 Mature Sequence: CACAGAACAUGCAGUGAGAACU mmu...more +inquiry

AM3491

MIRacle™ mmu-miR-344-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-344-3p Accession Number: MIMAT0000593 Mature Sequence: UGAUCUAGCCAAAGCCUGACUGU mmu...more +inquiry

AM3507

MIRacle™ mmu-miR-6968-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6968-3p Accession Number: MIMAT0027839 Mature Sequence: ACAAGCGCUGUCUCCCCUCCAG mmu...more +inquiry

AM3523

MIRacle™ mmu-miR-615-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-615-3p Accession Number: MIMAT0003783 Mature Sequence: UCCGAGCCUGGGUCUCCCUCUU mmu-...more +inquiry

AM3539

MIRacle™ mmu-miR-7666-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7666-5p Accession Number: MIMAT0029838 Mature Sequence: GUAGCCCGGGCGGUGCUUCCCC mmu...more +inquiry

AM3555

MIRacle™ mmu-miR-3474 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3474 Accession Number: MIMAT0015646 Mature Sequence: CCCUGGGAGGAGACGUGGAUUC mmu-mi...more +inquiry

AM3571

MIRacle™ mmu-miR-351-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-351-3p Accession Number: MIMAT0017042 Mature Sequence: GGUCAAGAGGCGCCUGGGAAC mmu-m...more +inquiry

AM3587

MIRacle™ mmu-miR-6972-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6972-3p Accession Number: MIMAT0027847 Mature Sequence: UUACUGUACCUGUCUCCAUAG mmu-...more +inquiry
AcceGen Scroll Top Button