Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.


  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.



MIRacle™ rno-miR-3102 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3102 Accession Number: MIMAT0025051 Mature Sequence CUCUACUCCCUGCCCCAGCCA rno-miR-...more +inquiry


MIRacle™ rno-miR-1188-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-1188-3p Accession Number: MIMAT0017855 Mature Sequence CGAGGCUCCCCACCACA rno-miR-...more +inquiry


MIRacle™ rno-miR-667-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-667-3p Accession Number: MIMAT0012852 Mature Sequence UGACACCUGCCACCCAGCCCAA rno-...more +inquiry


MIRacle™ rno-miR-673-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-673-3p Accession Number: MIMAT0017313 Mature Sequence UCCGGGACUGAGUUCUGUGCAC rno-...more +inquiry


MIRacle™ rno-miR-466b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-466b-5p Accession Number: MIMAT0005278 Mature Sequence UAUGUGUGUGUGUAUGUCCAUG rno...more +inquiry


MIRacle™ rno-miR-361-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-361-5p Accession Number: MIMAT0003117 Mature Sequence UUAUCAGAAUCUCCAGGGGUAC rno-...more +inquiry


MIRacle™ rno-miR-206-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-206-5p Accession Number: MIMAT0017154 Mature Sequence ACAUGCUUCUUUAUAUCCUCAU rno-...more +inquiry


MIRacle™ rno-miR-137-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-137-5p Accession Number: MIMAT0017126 Mature Sequence ACGGGUAUUCUUGGGUGGAUAA rno-...more +inquiry


MIRacle™ rno-miR-30a-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30a-5p Accession Number: MIMAT0000808 Mature Sequence UGUAAACAUCCUCGACUGGAAG rno-...more +inquiry


MIRacle™ rno-let-7b-3p miRNA Agomir/Antagomir

MicroRNA: rno-let-7b-3p Accession Number: MIMAT0004705 Mature Sequence CUAUACAACCUACUGCCUUCCC rno-l...more +inquiry


MIRacle™ rno-miR-6315 miRNA Agomir/Antagomir

MicroRNA: rno-miR-6315 Accession Number: MIMAT0025050 Mature Sequence UCUGGACAGGACAGGCCCUGAGC rno-m...more +inquiry


MIRacle™ rno-miR-1188-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-1188-5p Accession Number: MIMAT0017854 Mature Sequence UGGUGUGAGGUUGGGCCAGGA rno-...more +inquiry


MIRacle™ rno-miR-667-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-667-5p Accession Number: MIMAT0017369 Mature Sequence CGGUGCUGGUGGAGCAGUGAGCAC rn...more +inquiry


MIRacle™ rno-miR-673-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-673-5p Accession Number: MIMAT0005328 Mature Sequence CUCACAGCUCCGGUCCUUGGAG rno-...more +inquiry


MIRacle™ rno-miR-497-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-497-3p Accession Number: MIMAT0017230 Mature Sequence CCAAACCACACUGUGGUGUUAGA rno...more +inquiry


MIRacle™ rno-miR-501-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-501-3p Accession Number: MIMAT0017198 Mature Sequence AAUGCACCCGGGCAAGGAUUUGG rno...more +inquiry


MIRacle™ rno-miR-205 miRNA Agomir/Antagomir

MicroRNA: rno-miR-205 Accession Number: MIMAT0000878 Mature Sequence UCCUUCAUUCCACCGGAGUCUGU rno-mi...more +inquiry


MIRacle™ rno-miR-136-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-136-3p Accession Number: MIMAT0004733 Mature Sequence CAUCAUCGUCUCAAAUGAGUCU rno-...more +inquiry


MIRacle™ rno-miR-30d-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30d-3p Accession Number: MIMAT0004722 Mature Sequence CUUUCAGUCAGAUGUUUGCUGC rno-...more +inquiry


MIRacle™ rno-let-7b-5p miRNA Agomir/Antagomir

MicroRNA: rno-let-7b-5p Accession Number: MIMAT0000775 Mature Sequence UGAGGUAGUAGGUUGUGUGGUU rno-l...more +inquiry
AcceGen Scroll Top Button