Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM3895

MIRacle™ mmu-miR-5113 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5113 Accession Number: MIMAT0020621 Mature Sequence: ACAGAGGAGGAGAGAGAUCCUGU mmu-m...more +inquiry

AM3911

MIRacle™ mmu-miR-216a-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-216a-3p Accession Number: MIMAT0017054 Mature Sequence: CACAGUGGUCUCUGGGAUUAUG mmu...more +inquiry

AM3927

MIRacle™ mmu-miR-6989-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6989-3p Accession Number: MIMAT0027881 Mature Sequence: UGUCCACUGUCUCUGGUCCCAG mmu...more +inquiry

AM3943

MIRacle™ mmu-miR-343 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-343 Accession Number: MIMAT0004868 Mature Sequence: UCUCCCUUCAUGUGCCCAGA mmu-miR-3...more +inquiry

AM3959

MIRacle™ mmu-miR-465d-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-465d-5p Accession Number: MIMAT0029880 Mature Sequence: UAUUUAGAAUGGUACUGAUGUGA mm...more +inquiry

AM3975

MIRacle™ mmu-miR-466q miRNA Agomir/Antagomir

MicroRNA: mmu-miR-466q Accession Number: MIMAT0020631 Mature Sequence: GUGCACACACACACAUACGU mmu-miR-...more +inquiry

AM3991

MIRacle™ mmu-miR-320-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-320-5p Accession Number: MIMAT0017057 Mature Sequence: GCCUUCUCUUCCCGGUUCUUCC mmu-...more +inquiry

AM4007

MIRacle™ mmu-miR-6993-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6993-3p Accession Number: MIMAT0027889 Mature Sequence: CUUGCGUUUGUUUCCUCACAG mmu-...more +inquiry

AM4023

MIRacle™ mmu-miR-466b-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-466b-5p Accession Number: MIMAT0004875 Mature Sequence: UGAUGUGUGUGUACAUGUACAU mmu...more +inquiry

AM4039

MIRacle™ mmu-miR-216c-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-216c-5p Accession Number: MIMAT0029888 Mature Sequence: GAAGAAUCUCUACAGGUAAGUGU mm...more +inquiry

AM4055

MIRacle™ mmu-miR-5127 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5127 Accession Number: MIMAT0020638 Mature Sequence: UCUCCCAACCCUUUUCCCA mmu-miR-5...more +inquiry

AM4071

MIRacle™ mmu-miR-221-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-221-3p Accession Number: MIMAT0000669 Mature Sequence: AGCUACAUUGUCUGCUGGGUUUC mmu...more +inquiry

AM4087

MIRacle™ mmu-miR-6997-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6997-3p Accession Number: MIMAT0027897 Mature Sequence: UCAAACCUUACCCUCCUGUUUCC mm...more +inquiry

AM4103

MIRacle™ mmu-miR-466g miRNA Agomir/Antagomir

MicroRNA: mmu-miR-466g Accession Number: MIMAT0004883 Mature Sequence: AUACAGACACAUGCACACACA mmu-miR...more +inquiry

AM4119

MIRacle™ mmu-miR-7685-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7685-5p Accession Number: MIMAT0029896 Mature Sequence: ACCUUCCGGUUUCUUCAAGUCUCC m...more +inquiry

AM4135

MIRacle™ mmu-miR-5133 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5133 Accession Number: MIMAT0020644 Mature Sequence: GCUGGAGCUGCGGCAGCGCAG mmu-miR...more +inquiry

AM4151

MIRacle™ mmu-miR-135a-2-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-135a-2-3p Accession Number: MIMAT0017064 Mature Sequence: UGUAGGGAUGGAAGCCAUGAA mm...more +inquiry

AM4167

MIRacle™ mmu-miR-7001-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7001-3p Accession Number: MIMAT0027905 Mature Sequence: CGCUCACACUCCCUCUGCAG mmu-m...more +inquiry

AM4183

MIRacle™ mmu-miR-493-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-493-3p Accession Number: MIMAT0004888 Mature Sequence: UGAAGGUCCUACUGUGUGCCAGG mmu...more +inquiry

AM4199

MIRacle™ mmu-miR-1258-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1258-5p Accession Number: MIMAT0029904 Mature Sequence: UGCUGAGCUAAUUCCCUAACUG mmu...more +inquiry
AcceGen Scroll Top Button