Home > Products > Rat MicroRNA Agomir/Antagomir >

Rat MicroRNA Agomir/Antagomir

AcceGen Rat MicroRNA Agomir/Antagomir

Rat MicroRNAs (rno-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes, which are involved in the regulation of post-transcriptional gene expression in the rat. Rat MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the rat endogenous miRNA to regulate the biological function of the target gene. Rat MicroRNA Antagomir is an especially chemically modified miRNA antagonist.

Rat miRNA Agomir/Antagomir has higher stability/inhibitory effects in vivo and in vitro, and can overcome obstacles such as cell membranes and tissues in the body to enrich for target cells. In animal experiments, it can be administered by systemic or local injection, inhalation, feeding, etc. The effect can last for several weeks.


  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Rat MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.



MIRacle™ rno-miR-138-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-138-5p Accession Number: MIMAT0000844 Mature Sequence AGCUGGUGUUGUGAAUCAGGCCG rno...more +inquiry


MIRacle™ rno-miR-764-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-764-3p Accession Number: MIMAT0017370 Mature Sequence GAGGAGGCCAUAGUGGCAACUGU rno...more +inquiry


MIRacle™ rno-miR-32-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-32-5p Accession Number: MIMAT0000811 Mature Sequence UAUUGCACAUUACUAAGUUGCA rno-m...more +inquiry


MIRacle™ rno-miR-742-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-742-3p Accession Number: MIMAT0005333 Mature Sequence GAAAGCCACCAUGUUGGGUAAA rno-...more +inquiry


MIRacle™ rno-let-7f-2-3p miRNA Agomir/Antagomir

MicroRNA: rno-let-7f-2-3p Accession Number: MIMAT0017090 Mature Sequence CUAUACAGUCUACUGUCUUUC rno-...more +inquiry


MIRacle™ rno-miR-872-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-872-5p Accession Number: MIMAT0005282 Mature Sequence AAGGUUACUUGUUAGUUCAGG rno-m...more +inquiry


MIRacle™ rno-miR-326-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-326-5p Accession Number: MIMAT0017028 Mature Sequence GGGGGCAGGGCCUUUGUGAA rno-mi...more +inquiry


MIRacle™ rno-miR-412-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-412-3p Accession Number: MIMAT0003124 Mature Sequence CUUCACCUGGUCCACUAGCCGU rno-...more +inquiry


MIRacle™ rno-miR-6325 miRNA Agomir/Antagomir

MicroRNA: rno-miR-6325 Accession Number: MIMAT0025064 Mature Sequence AAAGUCAGACAGAGACUCUGCAG rno-m...more +inquiry


MIRacle™ rno-miR-217-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-217-5p Accession Number: MIMAT0000887 Mature Sequence UACUGCAUCAGGAACUGACUGG rno-...more +inquiry


MIRacle™ rno-miR-3596b miRNA Agomir/Antagomir

MicroRNA: rno-miR-3596b Accession Number: MIMAT0017871 Mature Sequence AACUAUGCAACCUACUACCU rno-miR...more +inquiry


MIRacle™ rno-miR-146a-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-146a-3p Accession Number: MIMAT0017132 Mature Sequence ACCUGUGAAGUUCAGUUCUUU rno-...more +inquiry


MIRacle™ rno-miR-449c-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-449c-5p Accession Number: MIMAT0017803 Mature Sequence AGGCAGUGCAUUGCUAGCUGG rno-...more +inquiry


MIRacle™ rno-miR-96-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-96-3p Accession Number: MIMAT0017110 Mature Sequence CAAUCAUGUGCAGUGCCAAUAU rno-m...more +inquiry


MIRacle™ rno-miR-652-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-652-3p Accession Number: MIMAT0005342 Mature Sequence AAUGGCGCCACUAGGGUUGUG rno-m...more +inquiry


MIRacle™ rno-miR-17-1-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-17-1-3p Accession Number: MIMAT0004710 Mature Sequence ACUGCAGUGAAGGCACUUGUGG rno...more +inquiry


MIRacle™ rno-miR-181d-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-181d-5p Accession Number: MIMAT0005299 Mature Sequence AACAUUCAUUGUUGUCGGUGGGU rn...more +inquiry


MIRacle™ rno-miR-336-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-336-5p Accession Number: MIMAT0000576 Mature Sequence UCACCCUUCCAUAUCUAGUCU rno-m...more +inquiry


MIRacle™ rno-miR-493-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-493-3p Accession Number: MIMAT0003191 Mature Sequence UGAAGGUCUACUGUGUGCCAG rno-m...more +inquiry


MIRacle™ rno-let-7g-3p miRNA Agomir/Antagomir

MicroRNA: rno-let-7g-3p Accession Number: MIMAT0035720 Mature Sequence CUGUACAGGCCACUGCCUUGC rno-le...more +inquiry
AcceGen Scroll Top Button