Home > Products > Rat miRNA Agomir/Antagomir >

Rat miRNA Agomir/Antagomir

Cat.# Name Description Price

AM5254

MIRacle™ rno-miR-3102 miRNA Agomir/Antagomir

Accession Number: MIMAT0025051 Mature Sequence CUCUACUCCCUGCCCCAGCCA rno-miR-3102 are small non-codi...more +inquiry

AM5253

MIRacle™ rno-miR-1188-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017855 Mature Sequence CGAGGCUCCCCACCACA rno-miR-1188-3p are small non-co...more +inquiry

AM5252

MIRacle™ rno-miR-667-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0012852 Mature Sequence UGACACCUGCCACCCAGCCCAA rno-miR-667-3p are small no...more +inquiry

AM5251

MIRacle™ rno-miR-673-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017313 Mature Sequence UCCGGGACUGAGUUCUGUGCAC rno-miR-673-3p are small no...more +inquiry

AM5250

MIRacle™ rno-miR-466b-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0005278 Mature Sequence UAUGUGUGUGUGUAUGUCCAUG rno-miR-466b-5p are small n...more +inquiry

AM5249

MIRacle™ rno-miR-361-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0003117 Mature Sequence UUAUCAGAAUCUCCAGGGGUAC rno-miR-361-5p are small no...more +inquiry

AM5248

MIRacle™ rno-miR-206-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0017154 Mature Sequence ACAUGCUUCUUUAUAUCCUCAU rno-miR-206-5p are small no...more +inquiry

AM5247

MIRacle™ rno-miR-137-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0017126 Mature Sequence ACGGGUAUUCUUGGGUGGAUAA rno-miR-137-5p are small no...more +inquiry

AM5246

MIRacle™ rno-miR-30a-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0000808 Mature Sequence UGUAAACAUCCUCGACUGGAAG rno-miR-30a-5p are small no...more +inquiry

AM5245

MIRacle™ rno-let-7b-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0004705 Mature Sequence CUAUACAACCUACUGCCUUCCC rno-let-7b-3p are small non...more +inquiry

AM5244

MIRacle™ rno-miR-6315 miRNA Agomir/Antagomir

Accession Number: MIMAT0025050 Mature Sequence UCUGGACAGGACAGGCCCUGAGC rno-miR-6315 are small non...more +inquiry

AM5243

MIRacle™ rno-miR-1188-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0017854 Mature Sequence UGGUGUGAGGUUGGGCCAGGA rno-miR-1188-5p are small no...more +inquiry

AM5242

MIRacle™ rno-miR-667-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0017369 Mature Sequence CGGUGCUGGUGGAGCAGUGAGCAC rno-miR-667-5p are small ...more +inquiry

AM5241

MIRacle™ rno-miR-673-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0005328 Mature Sequence CUCACAGCUCCGGUCCUUGGAG rno-miR-673-5p are small no...more +inquiry

AM5240

MIRacle™ rno-miR-497-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017230 Mature Sequence CCAAACCACACUGUGGUGUUAGA rno-miR-497-3p are small n...more +inquiry

AM5239

MIRacle™ rno-miR-501-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017198 Mature Sequence AAUGCACCCGGGCAAGGAUUUGG rno-miR-501-3p are small n...more +inquiry

AM5238

MIRacle™ rno-miR-205 miRNA Agomir/Antagomir

Accession Number: MIMAT0000878 Mature Sequence UCCUUCAUUCCACCGGAGUCUGU rno-miR-205 are small non-...more +inquiry

AM5237

MIRacle™ rno-miR-136-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0004733 Mature Sequence CAUCAUCGUCUCAAAUGAGUCU rno-miR-136-3p are small no...more +inquiry

AM5236

MIRacle™ rno-miR-30d-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0004722 Mature Sequence CUUUCAGUCAGAUGUUUGCUGC rno-miR-30d-3p are small no...more +inquiry

AM5235

MIRacle™ rno-let-7b-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0000775 Mature Sequence UGAGGUAGUAGGUUGUGUGGUU rno-let-7b-5p are small non...more +inquiry
AcceGen Scroll Top Button