Home > Products > Rat MicroRNA Agomir/Antagomir >

Rat MicroRNA Agomir/Antagomir

AcceGen Rat MicroRNA Agomir/Antagomir

Rat MicroRNAs (rno-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes, which are involved in the regulation of post-transcriptional gene expression in the rat. Rat MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the rat endogenous miRNA to regulate the biological function of the target gene. Rat MicroRNA Antagomir is an especially chemically modified miRNA antagonist.

Rat miRNA Agomir/Antagomir has higher stability/inhibitory effects in vivo and in vitro, and can overcome obstacles such as cell membranes and tissues in the body to enrich for target cells. In animal experiments, it can be administered by systemic or local injection, inhalation, feeding, etc. The effect can last for several weeks.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Rat MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM4492

MIRacle™ rno-miR-30a-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-30a-3p Accession Number: MIMAT0000809 Mature Sequence CUUUCAGUCGGAUGUUUGCAGC rno-...more +inquiry

AM4508

MIRacle™ rno-miR-674-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-674-3p Accession Number: MIMAT0005330 Mature Sequence CACAGCUCCCAUCUCAGAACAA rno-...more +inquiry

AM4524

MIRacle™ rno-let-7e-5p miRNA Agomir/Antagomir

MicroRNA: rno-let-7e-5p Accession Number: MIMAT0000777 Mature Sequence UGAGGUAGGAGGUUGUAUAGUU rno-l...more +inquiry

AM4540

MIRacle™ rno-miR-743b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-743b-5p Accession Number: MIMAT0017288 Mature Sequence UGUUCAGACUGGUGUCCAUCAU rno...more +inquiry

AM4556

MIRacle™ rno-miR-324-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-324-5p Accession Number: MIMAT0000553 Mature Sequence CGCAUCCCCUAGGGCAUUGGUGU rno...more +inquiry

AM4572

MIRacle™ rno-miR-370-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-370-3p Accession Number: MIMAT0003122 Mature Sequence GCCUGCUGGGGUGGAACCUGGU rno-...more +inquiry

AM4588

MIRacle™ rno-miR-1298 miRNA Agomir/Antagomir

MicroRNA: rno-miR-1298 Accession Number: MIMAT0025060 Mature Sequence UUCAUUCGGCUGUCCAGAUGUA rno-mi...more +inquiry

AM4604

MIRacle™ rno-miR-214-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-214-5p Accession Number: MIMAT0017159 Mature Sequence AGAGUUGUCAUGUGUCU rno-miR-2...more +inquiry

AM4620

MIRacle™ rno-miR-3579 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3579 Accession Number: MIMAT0017867 Mature Sequence GCGCAUGUUCUAUGGUCAACCA rno-mi...more +inquiry

AM4636

MIRacle™ rno-miR-144-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-144-3p Accession Number: MIMAT0000850 Mature Sequence UACAGUAUAGAUGAUGUACU rno-mi...more +inquiry

AM4652

MIRacle™ rno-miR-203b-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-203b-5p Accession Number: MIMAT0017799 Mature Sequence AGUGGUCCUAAACAUUUCAC rno-m...more +inquiry

AM4668

MIRacle™ rno-miR-92a-2-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-92a-2-5p Accession Number: MIMAT0017108 Mature Sequence AGGUGGGGAUUAGUGCCAUUAC rn...more +inquiry

AM4684

MIRacle™ rno-miR-92b-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-92b-3p Accession Number: MIMAT0005340 Mature Sequence UAUUGCACUCGUCCCGGCCUCC rno-...more +inquiry

AM4700

MIRacle™ rno-miR-15b-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-15b-3p Accession Number: MIMAT0017093 Mature Sequence CGAAUCAUUAUUUGCUGCUCUA rno-...more +inquiry

AM4716

MIRacle™ rno-miR-883-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-883-5p Accession Number: MIMAT0017294 Mature Sequence UGCUGAGAGAAGUAGCAGUUACU rno...more +inquiry

AM4732

MIRacle™ rno-miR-331-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-331-3p Accession Number: MIMAT0000570 Mature Sequence GCCCCUGGGCCUAUCCUAGAA rno-m...more +inquiry

AM4748

MIRacle™ rno-miR-541-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-541-3p Accession Number: MIMAT0017213 Mature Sequence AGUGGCGAACACAGAAUCCAUAC rno...more +inquiry

AM4764

MIRacle™ rno-miR-7578 miRNA Agomir/Antagomir

MicroRNA: rno-miR-7578 Accession Number: MIMAT0029579 Mature Sequence CGUGGCUCGUCUUCUGCCUCAGA rno-m...more +inquiry

AM4780

MIRacle™ rno-miR-223-5p miRNA Agomir/Antagomir

MicroRNA: rno-miR-223-5p Accession Number: MIMAT0017165 Mature Sequence CGUGUAUUUGACAAGCUGAGUUG rno...more +inquiry

AM4796

MIRacle™ rno-miR-3587 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3587 Accession Number: MIMAT0017883 Mature Sequence AACACUGAUUUCAAAUGGUGC rno-miR...more +inquiry
AcceGen Scroll Top Button