Dear AcceGen Customers,

Due to the recent COVID-19 pandemic, order shipment, processing times, and company hours may be affected. However, we are trying our best to provide high-quality products and services as usual. Thank you for your patience and continuous support. The health and safety of our customers and employees is always the highest priority for us. Need any support? Contact us at [email protected].

Home > Products > Rat MicroRNA Agomir/Antagomir >

Rat MicroRNA Agomir/Antagomir

AcceGen Rat MicroRNA Agomir/Antagomir

MicroRNAs (miRNAs) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. They are involved in the regulation of post-transcriptional gene expression in animals. Rat MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. Rat miRNA Agomir/Antagomir have higher stability and inhibitory effects in vivo and in vivo and can overcome obstacles such as cell membranes and tissues in the body to enrich for target cells. In animal experiments, it can be administered by systemic or local injection, inhalation, feeding, etc. The effect can last for several weeks.


  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Rat MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to pave new ways to meet all your needs.



MIRacle™ rno-miR-3102 miRNA Agomir/Antagomir

Accession Number: MIMAT0025051 Mature Sequence CUCUACUCCCUGCCCCAGCCA rno-miR-3102 are small non-co...more +inquiry


MIRacle™ rno-miR-1188-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017855 Mature Sequence CGAGGCUCCCCACCACA rno-miR-1188-3p are small non-cod...more +inquiry


MIRacle™ rno-miR-667-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0012852 Mature Sequence UGACACCUGCCACCCAGCCCAA rno-miR-667-3p are small non...more +inquiry


MIRacle™ rno-miR-673-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017313 Mature Sequence UCCGGGACUGAGUUCUGUGCAC rno-miR-673-3p are small non...more +inquiry


MIRacle™ rno-miR-466b-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0005278 Mature Sequence UAUGUGUGUGUGUAUGUCCAUG rno-miR-466b-5p are small no...more +inquiry


MIRacle™ rno-miR-361-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0003117 Mature Sequence UUAUCAGAAUCUCCAGGGGUAC rno-miR-361-5p are small non...more +inquiry


MIRacle™ rno-miR-206-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0017154 Mature Sequence ACAUGCUUCUUUAUAUCCUCAU rno-miR-206-5p are small non...more +inquiry


MIRacle™ rno-miR-137-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0017126 Mature Sequence ACGGGUAUUCUUGGGUGGAUAA rno-miR-137-5p are small non...more +inquiry


MIRacle™ rno-miR-30a-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0000808 Mature Sequence UGUAAACAUCCUCGACUGGAAG rno-miR-30a-5p are small non...more +inquiry


MIRacle™ rno-let-7b-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0004705 Mature Sequence CUAUACAACCUACUGCCUUCCC rno-let-7b-3p are small non-...more +inquiry


MIRacle™ rno-miR-6315 miRNA Agomir/Antagomir

Accession Number: MIMAT0025050 Mature Sequence UCUGGACAGGACAGGCCCUGAGC rno-miR-6315 are small non-...more +inquiry


MIRacle™ rno-miR-1188-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0017854 Mature Sequence UGGUGUGAGGUUGGGCCAGGA rno-miR-1188-5p are small non...more +inquiry


MIRacle™ rno-miR-667-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0017369 Mature Sequence CGGUGCUGGUGGAGCAGUGAGCAC rno-miR-667-5p are small n...more +inquiry


MIRacle™ rno-miR-673-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0005328 Mature Sequence CUCACAGCUCCGGUCCUUGGAG rno-miR-673-5p are small non...more +inquiry


MIRacle™ rno-miR-497-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017230 Mature Sequence CCAAACCACACUGUGGUGUUAGA rno-miR-497-3p are small no...more +inquiry


MIRacle™ rno-miR-501-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017198 Mature Sequence AAUGCACCCGGGCAAGGAUUUGG rno-miR-501-3p are small no...more +inquiry


MIRacle™ rno-miR-205 miRNA Agomir/Antagomir

Accession Number: MIMAT0000878 Mature Sequence UCCUUCAUUCCACCGGAGUCUGU rno-miR-205 are small non-c...more +inquiry


MIRacle™ rno-miR-136-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0004733 Mature Sequence CAUCAUCGUCUCAAAUGAGUCU rno-miR-136-3p are small non...more +inquiry


MIRacle™ rno-miR-30d-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0004722 Mature Sequence CUUUCAGUCAGAUGUUUGCUGC rno-miR-30d-3p are small non...more +inquiry


MIRacle™ rno-let-7b-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0000775 Mature Sequence UGAGGUAGUAGGUUGUGUGGUU rno-let-7b-5p are small non-...more +inquiry
AcceGen Scroll Top Button