Home > Products > Mouse MicroRNA Agomir/Antagomir >

Mouse MicroRNA Agomir/Antagomir

AcceGen Mouse MicroRNA Agomir/Antagomir

Mouse MicroRNAs (mmu-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes, which are involved in the regulation of post-transcriptional gene expression in the mouse. Mouse MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the mouse endogenous miRNA to regulate the biological function of the target gene. Mouse MicroRNA Antagomir is an especially chemically modified miRNA antagonist.

Mouse miRNA Agomir/Antagomir has higher stability/inhibitory effects in vivo and in vitro, and can overcome obstacles such as cell membranes and tissues in the body to enrich for target cells. In animal experiments, it can be administered by systemic or local injection, inhalation, feeding, etc. The effect can last for several weeks.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Mouse MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM4489

MIRacle™ mmu-miR-8106 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8106 Accession Number: MIMAT0031411 Mature Sequence: UGACUCUGUACAUGGCAUUUAU mmu-mi...more +inquiry

AM4488

MIRacle™ mmu-miR-7219-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7219-3p Accession Number: MIMAT0028407 Mature Sequence: UAUCCGGGUUUCUAACACACU mmu-...more +inquiry

AM4487

MIRacle™ mmu-miR-7016-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7016-3p Accession Number: MIMAT0027937 Mature Sequence: ACCUGCCUCCUGCUCUCCCCAG mmu...more +inquiry

AM4486

MIRacle™ mmu-miR-6924-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6924-5p Accession Number: MIMAT0027748 Mature Sequence: AGAGGAUGGGGAUUUGGCGAAGU mm...more +inquiry

AM4485

MIRacle™ mmu-miR-5626-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5626-5p Accession Number: MIMAT0022381 Mature Sequence: GCCCCAUCGAUUAACUGCUUCC mmu...more +inquiry

AM4484

MIRacle™ mmu-miR-3078-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3078-3p Accession Number: MIMAT0014865 Mature Sequence: UUGCUGGGGUAGUCUUUAGG mmu-m...more +inquiry

AM4483

MIRacle™ mmu-miR-511-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-511-3p Accession Number: MIMAT0017281 Mature Sequence: AAUGUGUAGCAAAAGACAGGAU mmu-...more +inquiry

AM4482

MIRacle™ mmu-miR-674-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-674-5p Accession Number: MIMAT0003740 Mature Sequence: GCACUGAGAUGGGAGUGGUGUA mmu-...more +inquiry

AM4481

MIRacle™ mmu-miR-378a-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-378a-5p Accession Number: MIMAT0000742 Mature Sequence: CUCCUGACUCCAGGUCCUGUGU mmu...more +inquiry

AM4480

MIRacle™ mmu-miR-208a-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-208a-5p Accession Number: MIMAT0017014 Mature Sequence: GAGCUUUUGGCCCGGGUUAUAC mmu...more +inquiry

AM4479

MIRacle™ mmu-miR-3535 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3535 Accession Number: MIMAT0031410 Mature Sequence: UGGAUAUGAUGACUGAUUACCUGAGA mm...more +inquiry

AM4478

MIRacle™ mmu-miR-7219-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7219-5p Accession Number: MIMAT0028406 Mature Sequence: UGUGUUAGAGCUCAGGGUUGAGA mm...more +inquiry

AM4477

MIRacle™ mmu-miR-7016-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7016-5p Accession Number: MIMAT0027936 Mature Sequence: CAGGGAGGGGAGCGAGAGUAG mmu-...more +inquiry

AM4476

MIRacle™ mmu-miR-6923-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6923-3p Accession Number: MIMAT0027747 Mature Sequence: ACACUCCCUCCUCCUCCCCAG mmu-...more +inquiry

AM4475

MIRacle™ mmu-miR-5625-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5625-3p Accession Number: MIMAT0022380 Mature Sequence: CUGAUUCAAGUGGUCUCUCGUGUCC ...more +inquiry

AM4474

MIRacle™ mmu-miR-3078-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3078-5p Accession Number: MIMAT0014864 Mature Sequence: CAAAGCCUAGACUGCAGCUACCU mm...more +inquiry

AM4473

MIRacle™ mmu-miR-511-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-511-5p Accession Number: MIMAT0004940 Mature Sequence: AUGCCUUUUGCUCUGCACUCA mmu-m...more +inquiry

AM4472

MIRacle™ mmu-miR-760-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-760-3p Accession Number: MIMAT0003898 Mature Sequence: CGGCUCUGGGUCUGUGGGGA mmu-mi...more +inquiry

AM4471

MIRacle™ mmu-miR-377-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-377-3p Accession Number: MIMAT0000741 Mature Sequence: AUCACACAAAGGCAACUUUUGU mmu-...more +inquiry

AM4470

MIRacle™ mmu-miR-200a-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-200a-3p Accession Number: MIMAT0000519 Mature Sequence: UAACACUGUCUGGUAACGAUGU mmu...more +inquiry
AcceGen Scroll Top Button