Home > Products > Mouse MicroRNA Agomir/Antagomir >

Mouse MicroRNA Agomir/Antagomir

AcceGen Mouse MicroRNA Agomir/Antagomir

Mouse MicroRNAs (mmu-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes, which are involved in the regulation of post-transcriptional gene expression in the mouse. Mouse MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the mouse endogenous miRNA to regulate the biological function of the target gene. Mouse MicroRNA Antagomir is an especially chemically modified miRNA antagonist.

Mouse miRNA Agomir/Antagomir has higher stability/inhibitory effects in vivo and in vitro, and can overcome obstacles such as cell membranes and tissues in the body to enrich for target cells. In animal experiments, it can be administered by systemic or local injection, inhalation, feeding, etc. The effect can last for several weeks.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Mouse MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM3293

MIRacle™ mmu-miR-711 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-711 Accession Number: MIMAT0003501 Mature Sequence: GGGACCCGGGGAGAGAUGUAAG mmu-miR...more +inquiry

AM3309

MIRacle™ mmu-miR-7654-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7654-3p Accession Number: MIMAT0029815 Mature Sequence: CGAGCGGGAGCGCGCCUCGUCC mmu...more +inquiry

AM3325

MIRacle™ mmu-miR-3105-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3105-3p Accession Number: MIMAT0014942 Mature Sequence: ACUGCUUAUGAGCUUGCACUCC mmu...more +inquiry

AM3341

MIRacle™ mmu-miR-337-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-337-5p Accession Number: MIMAT0004644 Mature Sequence: CGGCGUCAUGCAGGAGUUGAUU mmu-...more +inquiry

AM3357

MIRacle™ mmu-miR-6962-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6962-5p Accession Number: MIMAT0027824 Mature Sequence: AAGGACCUGGUGGGAGAUCU mmu-m...more +inquiry

AM3373

MIRacle™ mmu-miR-501-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-501-3p Accession Number: MIMAT0003509 Mature Sequence: AAUGCACCCGGGCAAGGAUUUG mmu-...more +inquiry

AM3389

MIRacle™ mmu-miR-7658-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7658-3p Accession Number: MIMAT0029823 Mature Sequence: ACCACCUUCCUCACCCACGCU mmu-...more +inquiry

AM3405

MIRacle™ mmu-miR-3110-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3110-5p Accession Number: MIMAT0014951 Mature Sequence: UUCUGCCUCCCCUGAAGGCUC mmu-...more +inquiry

AM3421

MIRacle™ mmu-miR-340-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-340-5p Accession Number: MIMAT0004651 Mature Sequence: UUAUAAAGCAAUGAGACUGAUU mmu-...more +inquiry

AM3437

MIRacle™ mmu-miR-3547-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3547-5p Accession Number: MIMAT0027832 Mature Sequence: GUGGGAAGAGGGGUGGGGCCCGGGA ...more +inquiry

AM3453

MIRacle™ mmu-miR-652-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-652-5p Accession Number: MIMAT0017260 Mature Sequence: CAACCCUAGGAGGGGGUGCCAUUC mm...more +inquiry

AM3469

MIRacle™ mmu-miR-7662-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7662-3p Accession Number: MIMAT0029831 Mature Sequence: UGGAGCCAGGCGGAUCAGCCUUGC m...more +inquiry

AM3485

MIRacle™ mmu-miR-3113-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3113-5p Accession Number: MIMAT0014959 Mature Sequence: GUCCUGGCCCUGGUCCGGGUCC mmu...more +inquiry

AM3501

MIRacle™ mmu-miR-345-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-345-5p Accession Number: MIMAT0000595 Mature Sequence: GCUGACCCCUAGUCCAGUGCUU mmu-...more +inquiry

AM3517

MIRacle™ mmu-miR-6969-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6969-5p Accession Number: MIMAT0027840 Mature Sequence: CAGCAGAGUAGGGAGCAAAAGA mmu...more +inquiry

AM3533

MIRacle™ mmu-miR-804 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-804 Accession Number: MIMAT0004210 Mature Sequence: UGUGAGUUGUUCCUCACCUGGA mmu-miR...more +inquiry

AM3549

MIRacle™ mmu-miR-7666-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7666-3p Accession Number: MIMAT0029839 Mature Sequence: GAUGCAGCGCACGGGCGAG mmu-mi...more +inquiry

AM3565

MIRacle™ mmu-miR-3960 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3960 Accession Number: MIMAT0019336 Mature Sequence: GGCGGCGGCGGAGGCGGGGG mmu-miR-...more +inquiry

AM3581

MIRacle™ mmu-miR-135b-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-135b-5p Accession Number: MIMAT0000612 Mature Sequence: UAUGGCUUUUCAUUCCUAUGUGA mm...more +inquiry

AM3597

MIRacle™ mmu-miR-6973a-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6973a-5p Accession Number: MIMAT0027848 Mature Sequence: UACGGUGGGAGGGGUGGAGUUG mm...more +inquiry
AcceGen Scroll Top Button