Home > Products > Mouse miRNA Agomir/Antagomir >

Mouse miRNA Agomir/Antagomir

Cat.# Name Description Price

AM4489

MIRacle™ mmu-miR-8106 miRNA Agomir/Antagomir

Accession Number: MIMAT0031411 Mature Sequence: UGACUCUGUACAUGGCAUUUAU mmu-miR-8106 are small non-c...more +inquiry

AM4488

MIRacle™ mmu-miR-7219-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0028407 Mature Sequence: UAUCCGGGUUUCUAACACACU mmu-miR-7219-3p are small non...more +inquiry

AM4487

MIRacle™ mmu-miR-7016-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0027937 Mature Sequence: ACCUGCCUCCUGCUCUCCCCAG mmu-miR-7016-3p are small no...more +inquiry

AM4486

MIRacle™ mmu-miR-6924-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0027748 Mature Sequence: AGAGGAUGGGGAUUUGGCGAAGU mmu-miR-6924-5p are small n...more +inquiry

AM4485

MIRacle™ mmu-miR-5626-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0022381 Mature Sequence: GCCCCAUCGAUUAACUGCUUCC mmu-miR-5626-5p are small no...more +inquiry

AM4484

MIRacle™ mmu-miR-3078-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0014865 Mature Sequence: UUGCUGGGGUAGUCUUUAGG mmu-miR-3078-3p are small non-...more +inquiry

AM4483

MIRacle™ mmu-miR-511-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017281 Mature Sequence: AAUGUGUAGCAAAAGACAGGAU mmu-miR-511-3p are small non...more +inquiry

AM4482

MIRacle™ mmu-miR-674-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0003740 Mature Sequence: GCACUGAGAUGGGAGUGGUGUA mmu-miR-674-5p are small non...more +inquiry

AM4481

MIRacle™ mmu-miR-378a-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0000742 Mature Sequence: CUCCUGACUCCAGGUCCUGUGU mmu-miR-378a-5p are small no...more +inquiry

AM4480

MIRacle™ mmu-miR-208a-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0017014 Mature Sequence: GAGCUUUUGGCCCGGGUUAUAC mmu-miR-208a-5p are small no...more +inquiry

AM4479

MIRacle™ mmu-miR-3535 miRNA Agomir/Antagomir

Accession Number: MIMAT0031410 Mature Sequence: UGGAUAUGAUGACUGAUUACCUGAGA mmu-miR-3535 are small n...more +inquiry

AM4478

MIRacle™ mmu-miR-7219-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0028406 Mature Sequence: UGUGUUAGAGCUCAGGGUUGAGA mmu-miR-7219-5p are small n...more +inquiry

AM4477

MIRacle™ mmu-miR-7016-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0027936 Mature Sequence: CAGGGAGGGGAGCGAGAGUAG mmu-miR-7016-5p are small non...more +inquiry

AM4476

MIRacle™ mmu-miR-6923-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0027747 Mature Sequence: ACACUCCCUCCUCCUCCCCAG mmu-miR-6923-3p are small non...more +inquiry

AM4475

MIRacle™ mmu-miR-5625-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0022380 Mature Sequence: CUGAUUCAAGUGGUCUCUCGUGUCC mmu-miR-5625-3p are small...more +inquiry

AM4474

MIRacle™ mmu-miR-3078-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0014864 Mature Sequence: CAAAGCCUAGACUGCAGCUACCU mmu-miR-3078-5p are small n...more +inquiry

AM4473

MIRacle™ mmu-miR-511-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0004940 Mature Sequence: AUGCCUUUUGCUCUGCACUCA mmu-miR-511-5p are small non-...more +inquiry

AM4472

MIRacle™ mmu-miR-760-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0003898 Mature Sequence: CGGCUCUGGGUCUGUGGGGA mmu-miR-760-3p are small non-c...more +inquiry

AM4471

MIRacle™ mmu-miR-377-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0000741 Mature Sequence: AUCACACAAAGGCAACUUUUGU mmu-miR-377-3p are small non...more +inquiry

AM4470

MIRacle™ mmu-miR-200a-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0000519 Mature Sequence: UAACACUGUCUGGUAACGAUGU mmu-miR-200a-3p are small no...more +inquiry
AcceGen Scroll Top Button