Home > Products > Mouse MicroRNA Agomir/Antagomir >

Mouse MicroRNA Agomir/Antagomir

AcceGen Mouse MicroRNA Agomir/Antagomir

Mouse MicroRNAs (mmu-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes, which are involved in the regulation of post-transcriptional gene expression in the mouse. Mouse MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the mouse endogenous miRNA to regulate the biological function of the target gene. Mouse MicroRNA Antagomir is an especially chemically modified miRNA antagonist.

Mouse miRNA Agomir/Antagomir has higher stability/inhibitory effects in vivo and in vitro, and can overcome obstacles such as cell membranes and tissues in the body to enrich for target cells. In animal experiments, it can be administered by systemic or local injection, inhalation, feeding, etc. The effect can last for several weeks.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Mouse MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM4113

MIRacle™ mmu-miR-466h-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-466h-5p Accession Number: MIMAT0004884 Mature Sequence: UGUGUGCAUGUGCUUGUGUGUA mmu...more +inquiry

AM4129

MIRacle™ mmu-miR-7685-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7685-3p Accession Number: MIMAT0029897 Mature Sequence: AGACUUGGCUUCCGGCUGGAG mmu-...more +inquiry

AM4145

MIRacle™ mmu-miR-5134-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5134-5p Accession Number: MIMAT0020645 Mature Sequence: UUGGCAGAAAGGGCAGCUGUG mmu-...more +inquiry

AM4161

MIRacle™ mmu-miR-19b-1-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-19b-1-5p Accession Number: MIMAT0017065 Mature Sequence: AGUUUUGCAGGUUUGCAUCCAGC m...more +inquiry

AM4177

MIRacle™ mmu-miR-7002-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7002-5p Accession Number: MIMAT0027906 Mature Sequence: UUGGCUUCGGGGAGUACGUGG mmu-...more +inquiry

AM4193

MIRacle™ mmu-miR-504-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-504-5p Accession Number: MIMAT0004889 Mature Sequence: AGACCCUGGUCUGCACUCUAUC mmu-...more +inquiry

AM4209

MIRacle™ mmu-miR-1258-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1258-3p Accession Number: MIMAT0029905 Mature Sequence: UUAGGGAAUUAGCUCAGCAGUA mmu...more +inquiry

AM4225

MIRacle™ mmu-miR-5615-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5615-5p Accession Number: MIMAT0022355 Mature Sequence: CUUGGUUGUUUUCUGAGACAGA mmu...more +inquiry

AM4241

MIRacle™ mmu-miR-128-2-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-128-2-5p Accession Number: MIMAT0017069 Mature Sequence: GGGGGCCGAUGCACUGUAAGAGA m...more +inquiry

AM4257

MIRacle™ mmu-miR-7005-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7005-5p Accession Number: MIMAT0027914 Mature Sequence: CCUGGGGAUGGGAGGACCAGCA mmu...more +inquiry

AM4273

MIRacle™ mmu-miR-590-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-590-3p Accession Number: MIMAT0004896 Mature Sequence: UAAUUUUAUGUAUAAGCUAGU mmu-m...more +inquiry

AM4289

MIRacle™ mmu-miR-8090 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8090 Accession Number: MIMAT0031391 Mature Sequence: GAAGCGCAGUGGAGGUCUGU mmu-miR-...more +inquiry

AM4305

MIRacle™ mmu-miR-5618-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5618-5p Accession Number: MIMAT0022363 Mature Sequence: UACCCUUUACACCGUGUAGU mmu-m...more +inquiry

AM4321

MIRacle™ mmu-miR-194-2-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-194-2-3p Accession Number: MIMAT0017073 Mature Sequence: CCAGUGGGGCUGCUGUUAUCUG mm...more +inquiry

AM4337

MIRacle™ mmu-miR-7009-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7009-5p Accession Number: MIMAT0027922 Mature Sequence: UUGGGGUCAGGGGACCAGAGCU mmu...more +inquiry

AM4353

MIRacle™ mmu-miR-878-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-878-5p Accession Number: MIMAT0004932 Mature Sequence: UAUCUAGUUGGAUGUCAAGACA mmu-...more +inquiry

AM4369

MIRacle™ mmu-miR-8097 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8097 Accession Number: MIMAT0031399 Mature Sequence: AACAAGGAAAAUGUCCGGGCUG mmu-mi...more +inquiry

AM4385

MIRacle™ mmu-miR-5622-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5622-5p Accession Number: MIMAT0022371 Mature Sequence: UUCACCACACCCAGCUUAAAGA mmu...more +inquiry

AM4401

MIRacle™ mmu-miR-365-1-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-365-1-5p Accession Number: MIMAT0017077 Mature Sequence: AGGGACUUUUGGGGGCAGAUGUG m...more +inquiry

AM4417

MIRacle™ mmu-miR-7013-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7013-5p Accession Number: MIMAT0027930 Mature Sequence: UAUGAAGAGGCCAGUGUUGUAG mmu...more +inquiry
AcceGen Scroll Top Button