Home > Products > Mouse MicroRNA Agomir/Antagomir >

Mouse MicroRNA Agomir/Antagomir

AcceGen Mouse MicroRNA Agomir/Antagomir

Mouse MicroRNAs (mmu-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes, which are involved in the regulation of post-transcriptional gene expression in the mouse. Mouse MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the mouse endogenous miRNA to regulate the biological function of the target gene. Mouse MicroRNA Antagomir is an especially chemically modified miRNA antagonist.

Mouse miRNA Agomir/Antagomir has higher stability/inhibitory effects in vivo and in vitro, and can overcome obstacles such as cell membranes and tissues in the body to enrich for target cells. In animal experiments, it can be administered by systemic or local injection, inhalation, feeding, etc. The effect can last for several weeks.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Mouse MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM3301

MIRacle™ mmu-miR-330-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-330-5p Accession Number: MIMAT0004642 Mature Sequence: UCUCUGGGCCUGUGUCUUAGGC mmu-...more +inquiry

AM3317

MIRacle™ mmu-miR-6960-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6960-5p Accession Number: MIMAT0027820 Mature Sequence: CAGGAUGAGAAGAGUUUGGCUG mmu...more +inquiry

AM3333

MIRacle™ mmu-miR-714 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-714 Accession Number: MIMAT0003505 Mature Sequence: CGACGAGGGCCGGUCGGUCGC mmu-miR-...more +inquiry

AM3349

MIRacle™ mmu-miR-7656-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7656-3p Accession Number: MIMAT0029819 Mature Sequence: ACAGGCUGUCUGAUCCCACGGU mmu...more +inquiry

AM3365

MIRacle™ mmu-miR-3108-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3108-5p Accession Number: MIMAT0014947 Mature Sequence: GUCUCUAAAGCUAGACGUUCCGG mm...more +inquiry

AM3381

MIRacle™ mmu-miR-338-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-338-5p Accession Number: MIMAT0004647 Mature Sequence: AACAAUAUCCUGGUGCUGAGUG mmu-...more +inquiry

AM3397

MIRacle™ mmu-miR-6964-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6964-5p Accession Number: MIMAT0027828 Mature Sequence: UUGGGGUGUGAGACUGGAAAC mmu-...more +inquiry

AM3413

MIRacle™ mmu-miR-505-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-505-5p Accession Number: MIMAT0017259 Mature Sequence: GGGAGCCAGGAAGUAUUGAUGUU mmu...more +inquiry

AM3429

MIRacle™ mmu-miR-7660-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7660-3p Accession Number: MIMAT0029827 Mature Sequence: AUCUGUAAGUGAUGGGCAAAGUA mm...more +inquiry

AM3445

MIRacle™ mmu-miR-3112-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3112-5p Accession Number: MIMAT0014955 Mature Sequence: ACAUAGAAAAGGCAGUCUGCA mmu-...more +inquiry

AM3461

MIRacle™ mmu-miR-342-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-342-5p Accession Number: MIMAT0004653 Mature Sequence: AGGGGUGCUAUCUGUGAUUGAG mmu-...more +inquiry

AM3477

MIRacle™ mmu-miR-6967-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6967-5p Accession Number: MIMAT0027836 Mature Sequence: CAGGGAGGGAUAAAGACCAGU mmu-...more +inquiry

AM3493

MIRacle™ mmu-miR-676-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-676-5p Accession Number: MIMAT0003781 Mature Sequence: ACUCUACAACCUUAGGACUUGC mmu-...more +inquiry

AM3509

MIRacle™ mmu-miR-7664-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7664-3p Accession Number: MIMAT0029835 Mature Sequence: UCUCUUAGGCUGGGUUAACUAAU mm...more +inquiry

AM3525

MIRacle™ mmu-miR-3471 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3471 Accession Number: MIMAT0015642 Mature Sequence: UGAGAUCCAACUGUAAGGCAUU mmu-mi...more +inquiry

AM3541

MIRacle™ mmu-miR-350-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-350-5p Accession Number: MIMAT0017040 Mature Sequence: AAAGUGCAUGCGCUUUGGG mmu-miR...more +inquiry

AM3557

MIRacle™ mmu-miR-6971-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6971-5p Accession Number: MIMAT0027844 Mature Sequence: UGGGGGAGGGUGUAGAGGCU mmu-m...more +inquiry

AM3573

MIRacle™ mmu-miR-742-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-742-3p Accession Number: MIMAT0004237 Mature Sequence: GAAAGCCACCAUGCUGGGUAAA mmu-...more +inquiry

AM3589

MIRacle™ mmu-miR-7668-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7668-3p Accession Number: MIMAT0029843 Mature Sequence: CGGUGCAGGGGAUUCAGAGGAG mmu...more +inquiry

AM3605

MIRacle™ mmu-miR-3963 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3963 Accession Number: MIMAT0019341 Mature Sequence: UGUAUCCCACUUCUGACAC mmu-miR-3...more +inquiry
AcceGen Scroll Top Button