Dear AcceGen Customers,

Due to the recent COVID-19 pandemic, order shipment, processing times, and company hours may be affected. However, we are trying our best to provide high-quality products and services as usual. Thank you for your patience and continuous support. The health and safety of our customers and employees is always the highest priority for us. Need any support? Contact us at


Home > Products > Mouse MicroRNA Agomir/Antagomir >

Mouse MicroRNA Agomir/Antagomir

AcceGen Mouse MicroRNA Agomir/Antagomir

MicroRNAs (miRNAs) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. They are involved in the regulation of post-transcriptional gene expression in animals. Mouse MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. Mouse miRNA Agomir/Antagomir have higher stability and inhibitory effects in vivo and in vitro and can overcome obstacles such as cell membranes and tissues in the body to enrich for target cells. In animal experiments, it can be administered by systemic or local injection, inhalation, feeding, etc. The effect can last for several weeks.


  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use Rat MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to pave new ways to meet all your needs.



MIRacle™ mmu-miR-8106 miRNA Agomir/Antagomir

Accession Number: MIMAT0031411 Mature Sequence: UGACUCUGUACAUGGCAUUUAU mmu-miR-8106 are small non-c...more +inquiry


MIRacle™ mmu-miR-7219-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0028407 Mature Sequence: UAUCCGGGUUUCUAACACACU mmu-miR-7219-3p are small non...more +inquiry


MIRacle™ mmu-miR-7016-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0027937 Mature Sequence: ACCUGCCUCCUGCUCUCCCCAG mmu-miR-7016-3p are small no...more +inquiry


MIRacle™ mmu-miR-6924-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0027748 Mature Sequence: AGAGGAUGGGGAUUUGGCGAAGU mmu-miR-6924-5p are small n...more +inquiry


MIRacle™ mmu-miR-5626-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0022381 Mature Sequence: GCCCCAUCGAUUAACUGCUUCC mmu-miR-5626-5p are small no...more +inquiry


MIRacle™ mmu-miR-3078-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0014865 Mature Sequence: UUGCUGGGGUAGUCUUUAGG mmu-miR-3078-3p are small non-...more +inquiry


MIRacle™ mmu-miR-511-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017281 Mature Sequence: AAUGUGUAGCAAAAGACAGGAU mmu-miR-511-3p are small non...more +inquiry


MIRacle™ mmu-miR-674-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0003740 Mature Sequence: GCACUGAGAUGGGAGUGGUGUA mmu-miR-674-5p are small non...more +inquiry


MIRacle™ mmu-miR-378a-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0000742 Mature Sequence: CUCCUGACUCCAGGUCCUGUGU mmu-miR-378a-5p are small no...more +inquiry


MIRacle™ mmu-miR-208a-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0017014 Mature Sequence: GAGCUUUUGGCCCGGGUUAUAC mmu-miR-208a-5p are small no...more +inquiry


MIRacle™ mmu-miR-3535 miRNA Agomir/Antagomir

Accession Number: MIMAT0031410 Mature Sequence: UGGAUAUGAUGACUGAUUACCUGAGA mmu-miR-3535 are small n...more +inquiry


MIRacle™ mmu-miR-7219-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0028406 Mature Sequence: UGUGUUAGAGCUCAGGGUUGAGA mmu-miR-7219-5p are small n...more +inquiry


MIRacle™ mmu-miR-7016-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0027936 Mature Sequence: CAGGGAGGGGAGCGAGAGUAG mmu-miR-7016-5p are small non...more +inquiry


MIRacle™ mmu-miR-6923-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0027747 Mature Sequence: ACACUCCCUCCUCCUCCCCAG mmu-miR-6923-3p are small non...more +inquiry


MIRacle™ mmu-miR-5625-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0022380 Mature Sequence: CUGAUUCAAGUGGUCUCUCGUGUCC mmu-miR-5625-3p are small...more +inquiry


MIRacle™ mmu-miR-3078-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0014864 Mature Sequence: CAAAGCCUAGACUGCAGCUACCU mmu-miR-3078-5p are small n...more +inquiry


MIRacle™ mmu-miR-511-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0004940 Mature Sequence: AUGCCUUUUGCUCUGCACUCA mmu-miR-511-5p are small non-...more +inquiry


MIRacle™ mmu-miR-760-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0003898 Mature Sequence: CGGCUCUGGGUCUGUGGGGA mmu-miR-760-3p are small non-c...more +inquiry


MIRacle™ mmu-miR-377-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0000741 Mature Sequence: AUCACACAAAGGCAACUUUUGU mmu-miR-377-3p are small non...more +inquiry


MIRacle™ mmu-miR-200a-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0000519 Mature Sequence: UAACACUGUCUGGUAACGAUGU mmu-miR-200a-3p are small no...more +inquiry
AcceGen Scroll Top Button