MIRacle™ hsa-miR-10b-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-10b-5p

Accession Number: MIMAT0000254

Mature Sequence: UACCCUGUAGAACCGAAUUUGUG

hsa-miR-10b-5p, a 23-nucleotide microRNA specific to Homo sapiens, presents a multifaceted role in various biological contexts. This microRNA engages with several protein-coding genes, including 14-3-3, 182-FIP, 21-GARP, among others, and exhibits irregular expression patterns in breast cancer. While its precise involvement in tumorigenesis remains enigmatic, it is associated with potential target genes (BIRC5, E2F2, KIF2C, FOXM1, and MCM5) closely linked to cell cycle regulation. Moreover, miR-10b-5p has been identified as a pivotal regulator in conditions like diabetes and gastrointestinal dysmotility through the KLF11-KIT pathway. It also correlates with the age of onset and the extent of striatal involvement in Huntington’s disease and plays a role in regulating neurofibromatosis 1 (NF1)-glioma migration. Click here to browse detailed information about hsa-miR-10b-5p in miRBase.

Introduction and application of hsa-miR-10b-5p miRNA Agomir/Antagomir

hsa-miR-10b-5p miRNA Agomir and Antagomir have found versatile applications in various research contexts. They have been instrumental in investigating the role of miR-10b-5p in breast cancer, delving into the intricate network of its target genes through bioinformatics analysis. These tools have also played a crucial role in exploring the contributions of miRs in NF1-associated gliomas. Furthermore, they have been employed to probe the impact of miRNA dysregulation on gene expression, disease progression, and the severity of Huntington’s disease. MicroRNA Agomir, acting as a mimic, regulates target gene function, while MicroRNA Antagomir competes with endogenous miRNAs to inhibit their regulatory roles, offering valuable insights into these complex biological processes.

Why choose hsa-miR-10b-5p miRNA Agomir/Antagomir from AcceGen?

In contrast to conventional miRNA mimics and inhibitors, AcceGen’s miRNA Agomir and Antagomir exhibit heightened stability, ensuring a sustained impact, with a minimum duration of effectiveness lasting for one week and, in some cases, extending to as long as 5-6 weeks. This exceptional durability renders these products invaluable for both in vitro and in vivo miRNA functional investigations.