+1 862-686-2696
Featured Products
Primary Cells
Immortalized Cell Lines
Stem Cells
Tumor Cell Lines
Transfected Stable Cell Lines
Exosomes
MicroRNA Agomir/Antagomir
Nucleic Acid Kits
Explore Products
Cell
Cell
MicroRNA
MicroRNA
Test and Analysis
Test and Analysis
MicroRNA Agomir/Antagomir

MIRacle™ hsa-miR-192-5p miRNA Agomir/Antagomir

  • 90
MicroRNA: hsa-miR-192-5p Accession Number: MIMAT0000222 Mature Sequence: CUGACCUAUGAAUUGACAGCC hsa-miR-192-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Home | MicroRNA Agomir/Antagomir | Human MicroRNA Agomir/Antagomir | MIRacle™ hsa-miR-192-5p miRNA Agomir/Antagomir
Species

Human
Cat.No

AM2223
Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)
Shipping Info

Room Temperature
Storage

-20°C / -80°C
Product Type

microRNA Agomir/Antagomir
Label

FAM, CY3, CY5, etc. (optional)
Component

hsa-miR-192-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)
Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

MIRacle™ hsa-miR-192-5p miRNA Agomir/Antagomir is a chemically modified synthetic oligonucleotide developed to precisely modulate the activity of endogenous microRNAs. The Agomir functions as a miRNA mimic, effectively enhancing the expression and biological activity of hsa-miR-192-5p. Whereas the Antagomir serves as a sequence-specific antagonist, inhibiting hsa-miR-192-5p function. Both formulations are optimized for high stability and efficacy in in vitro and in vivo settings.
AcceGen provides the MIRacle™ series in multiple specifications (2 OD, 4 OD, 50 OD) with HPLC purification to accommodate a diverse range of experimental requirements. These reagents are ideal for investigating the role of target miRNA in key biological processes including cancer stem cell diagnosis and non-alcoholic fatty liver disease (NAFLD) research.

AcceGen Frozen Cells & Cell Lines
View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • MIRacle™ hsa-miR-192-5p miRNA Agomir/Antagomir can be used to study the mechanisms of cancer occurrence and development such as lung, liver, breast and gastric cancer. It can also be used as a monitoring indicator for the progression of liver diseases such as chronic hepatitis B (CHB)

  • Online Inquiry
  • Product Reviews

Inquiring MIRacle™ hsa-miR-192-5p miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

Let's Advance Life Science Research Together

Contact Us
AcceGen Scroll Top Button