| Species |
Mouse
|
| Cat.No |
AM2840
|
| Product Category |
MicroRNA Agomir/Antagomir |
| Size/Quantity |
2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)
|
| Shipping Info |
Room Temperature
|
| Storage |
-20°C / -80°C
|
| Product Type |
microRNA Agomir/Antagomir
|
| Label |
FAM, CY3, CY5, etc. (optional)
|
| Component |
mmu-miR-21a-3p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)
|
| Key Features |
*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time
|
Description
MicroRNA: mmu-miR-21a-3p
Accession Number: MIMAT0004628
Mature Sequence: CAACAGCAGUCGAUGGGCUGUC
mmu-miR-21a-3p is a microRNA that plays a significant role in various biological processes and diseases. It is involved in angiogenesis, particularly through regulating the PI3K p110α pathway, which is essential for endothelial regeneration and angiogenesis. In addition, mmu-miR-21a-3p has been associated with epilepsy in mice. It targets SNCA, and its overexpression causes a considerable increase in SNCA expression, indicating a potential involvement in the development of epilepsy. Furthermore, mmu-miR-21a-3p has been found to be significantly correlated with the immune regulator Acvr2a. The expression of mmu-miR-21a-3p and Acvr2a is opposite after asthma and BM-MSCs treatment, suggesting that the miR-21/Acvr2a axis plays a crucial role in the induction of asthmatic inflammation.
Click here to browse detailed information about mmu-miR-21a-3p in miRBase.
Introduction and Application of mmu-miR-21a-3p miRNA Agomir/Antagomir
mmu-miR-21a-3p miRNA Agomir is a chemically modified double-stranded small RNA that mimics the endogenous miRNA. It can regulate the biological function of target genes by posttranscriptional degradation of mRNA or translational inhibition of protein expression. On the other hand, mmu-miR-21a-3p miRNA Antagomir is a chemically modified miRNA antagonist. It competes strongly with mature miRNAs in the body, preventing their binding to target genes. This inhibition of miRNA function provides a means to study and modulate the expression of specific genes.
Why choose mmu-miR-21a-3p miRNA Agomir/Antagomir from AcceGen?
AcceGen offers mmu-miR-21a-3p miRNA Agomir/Antagomir, providing lasting effects for up to 5-6 weeks due to enhanced stability. With a wide range of miRNAs covered, including mmu-miR-21a-3p, researchers can conduct in vitro and in vivo miRNA functional studies. AcceGen’s expertise ensures reliable tools for investigating the biological functions and mechanisms of mmu-miR-21a-3p.
