Home > Products > MicroRNA Agomir/Antagomir > Mouse MicroRNA Agomir/Antagomir >

MIRacle™ mmu-miR-483-5p miRNA Agomir/Antagomir

Product Name

MIRacle™ mmu-miR-483-5p miRNA Agomir/Antagomir

Price Get Quote
Cat.No

AM3322

Species

Mouse

Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Description

MicroRNA: mmu-miR-483-5p

Accession Number: MIMAT0004782
Mature Sequence: AAGACGGGAGAAGAGAAGGGAG
mmu-miR-483-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-483-5p in miRBase.

 

What is MicroRNA Agomir/Antagomir?

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

 

Why choose mmu-miR-483-5p miRNA Agomir/Antagomir from AcceGen?

AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Recommended Medium And Supplement
Citation Guide

When you publish your research, please cite our product as "AcceGen Biotech Cat.# XXX-0000". In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Label

FAM, CY3, CY5, etc. (optional)

Application

For research use only

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Component

mmu-miR-483-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Product Type

microRNA Agomir/Antagomir

Product Image AcceGen Frozen Cells & Cell Lines AcceGen Frozen Cells & Cell Lines
Tech Document

MIRacle™ Agomir Product Manual

MIRacle™ Antagomir Product Manual

MSDS-AcceGen MicroRNA Agomir

MSDS-AcceGen MicroRNA Antagomir

  • ONLINE INQUIRY
  • PRODUCT REVIEWS
We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time?

Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
Privacy Policy: AcceGen will never sell, rent, or share your personal information with any third parties without your express permission.
Reviews of MIRacle™ mmu-miR-483-5p miRNA Agomir/Antagomir
AcceGen is always trying to do right by our customers and working hard to build a higher quality product.

Your email address will not be published.

AcceGen Scroll Top Button