Home > Products > MicroRNA Agomir/Antagomir > Mouse MicroRNA Agomir/Antagomir >
MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir | ||||
---|---|---|---|---|
Product Name | MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir | |||
Price | Get Quote | |||
Cat.No | AM3890 | Species | Mouse | |
Size/Quantity | 2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug) | |||
Shipping Info | Room Temperature | Storage | -20°C / -80°C | |
Description | MicroRNA: mmu-miR-122-5p Accession Number: MIMAT0000246 Mature Sequence: UGGAGUGUGACAAUGGUGUUUG
mmu-miR-122-5p, a 22-nucleotide-long miRNA originating from Mus musculus, exerts crucial regulatory functions in diverse physiological processes. It influences the tight junction of the blood-testis barrier in mice by targeting occludin, showcasing its role in maintaining barrier integrity. Additionally, mmu-miR-122-5p exhibits expression in renal proximal tubules and myocardial tissue, suggesting its involvement in various organ-specific processes.
Introduction and application of mmu-miR-122-5p miRNA Agomir/Antagomir MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir is a cutting-edge molecular tool designed for precise modulation of mmu-miR-122-5p expression. The Agomir version allows for efficient upregulation of miR-122-5p, enabling researchers to investigate its impact on various cellular processes and disease pathways. On the other hand, the Antagomir version offers the ability to selectively suppress miR-122-5p, allowing for in-depth studies of its downregulation effects. These tools provide insights into miR-122-5p’s functional roles and potential therapeutic applications in relevant diseases.
Why choose mmu-miR-122-5p miRNA Agomir/Antagomir from AcceGen? MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir from AcceGen is an ideal choice due to our extensive expertise in microRNA synthesis. Our agomir and antagomir options are more durable, offering lasting effects of up to 5-6 weeks compared to standard mimics and inhibitors. They are ideal for in vitro and in vivo miRNA functional studies, ensuring reliable and long-lasting results. | |||
Recommended Medium And Supplement | DEPC H2O | |||
Citation Guide | When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID). | |||
Label | FAM, CY3, CY5, etc. (optional) | |||
Application | For research use only | |||
Key Features | *cover all human, mouse, and rat miRNAs listed in miRBase | |||
Component | mmu-miR-122-5p Agomir and/or Antagomir (Product Form: Dry Powder) | |||
Product Type | microRNA Agomir/Antagomir | |||
Product Image | ![]() ![]() | |||
Tech Document | MIRacle™ Agomir Product Manual |
Related Products
- ONLINE INQUIRY
- PRODUCT REVIEWS
Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.