| Species |
Mouse
|
| Cat.No |
AM3890
|
| Product Category |
MicroRNA Agomir/Antagomir |
| Size/Quantity |
2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)
|
| Shipping Info |
Room Temperature
|
| Storage |
-20°C / -80°C
|
| Product Type |
microRNA Agomir/Antagomir
|
| Label |
FAM, CY3, CY5, etc. (optional)
|
| Component |
mmu-miR-122-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)
|
| Key Features |
*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time
|
Description
MicroRNA: mmu-miR-122-5p
Accession Number: MIMAT0000246
Mature Sequence: UGGAGUGUGACAAUGGUGUUUG
mmu-miR-122-5p, a 22-nucleotide-long miRNA originating from Mus musculus, exerts crucial regulatory functions in diverse physiological processes. It influences the tight junction of the blood-testis barrier in mice by targeting occludin, showcasing its role in maintaining barrier integrity. Additionally, mmu-miR-122-5p exhibits expression in renal proximal tubules and myocardial tissue, suggesting its involvement in various organ-specific processes. 
Remarkably, this miRNA has been linked to diabetes mellitus development, possibly contributing to disease pathogenesis. Moreover, mmu-miR-122-5p has been identified as a potent pro-angiogenic factor that stimulates vascular endothelial growth factor signaling, promoting angiogenesis both in vivo and in vitro. Click here to browse detailed information about mmu-miR-122-5p in miRBase.
Introduction and application of mmu-miR-122-5p miRNA Agomir/Antagomir
MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir is a cutting-edge molecular tool designed for precise modulation of mmu-miR-122-5p expression. The Agomir version allows for efficient upregulation of miR-122-5p, enabling researchers to investigate its impact on various cellular processes and disease pathways. On the other hand, the Antagomir version offers the ability to selectively suppress miR-122-5p, allowing for in-depth studies of its downregulation effects. These tools provide insights into miR-122-5p’s functional roles and potential therapeutic applications in relevant diseases.
Why choose mmu-miR-122-5p miRNA Agomir/Antagomir from AcceGen?
MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir from AcceGen is an ideal choice due to our extensive expertise in microRNA synthesis. Our agomir and antagomir options are more durable, offering lasting effects of up to 5-6 weeks compared to standard mimics and inhibitors. They are ideal for in vitro and in vivo miRNA functional studies, ensuring reliable and long-lasting results.
