MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-122-5p

Accession Number: MIMAT0000246

Mature Sequence: UGGAGUGUGACAAUGGUGUUUG

mmu-miR-122-5p, a 22-nucleotide-long miRNA originating from Mus musculus, exerts crucial regulatory functions in diverse physiological processes. It influences the tight junction of the blood-testis barrier in mice by targeting occludin, showcasing its role in maintaining barrier integrity. Additionally, mmu-miR-122-5p exhibits expression in renal proximal tubules and myocardial tissue, suggesting its involvement in various organ-specific processes. Remarkably, this miRNA has been linked to diabetes mellitus development, possibly contributing to disease pathogenesis. Moreover, mmu-miR-122-5p has been identified as a potent pro-angiogenic factor that stimulates vascular endothelial growth factor signaling, promoting angiogenesis both in vivo and in vitro. Click here to browse detailed information about mmu-miR-122-5p in miRBase.

Introduction and application of mmu-miR-122-5p miRNA Agomir/Antagomir

MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir is a cutting-edge molecular tool designed for precise modulation of mmu-miR-122-5p expression. The Agomir version allows for efficient upregulation of miR-122-5p, enabling researchers to investigate its impact on various cellular processes and disease pathways. On the other hand, the Antagomir version offers the ability to selectively suppress miR-122-5p, allowing for in-depth studies of its downregulation effects. These tools provide insights into miR-122-5p’s functional roles and potential therapeutic applications in relevant diseases.

Why choose mmu-miR-122-5p miRNA Agomir/Antagomir from AcceGen?

MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir from AcceGen is an ideal choice due to  our extensive expertise in microRNA synthesis. Our agomir and antagomir options are more durable, offering lasting effects of up to 5-6 weeks compared to standard mimics and inhibitors. They are ideal for in vitro and in vivo miRNA functional studies, ensuring reliable and long-lasting results.