Home > Products > MicroRNA Agomir/Antagomir > Mouse MicroRNA Agomir/Antagomir >
MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir | ||||
---|---|---|---|---|
Product Name | MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir | |||
Price | Get Quote | |||
Cat.No | AM3380 | Species | Mouse | |
Size/Quantity | 2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug) | |||
Shipping Info | Room Temperature | Storage | -20°C / -80°C | |
Description | MicroRNA: mmu-miR-155-5p Accession Number: MIMAT0000165 Mature Sequence: UUAAUGCUAAUUGUGAUAGGGGU
Introduction and application of mmu-miR-155-5p miRNA Agomir/Antagomir The MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir holds significant promise in cancer research and prognosis assessment. MiR-155, which is found in high levels in various solid tumors and hematological malignancies, plays a critical role in promoting oncogenic features and is associated with poor prognosis in cancer patients. The miRNA Agomir in this context mimics and enhances the function of miR-155, potentially aiding in understanding its role in tumorigenesis and as an unfavorable prognosis indicator. Conversely, the miRNA Antagomir serves as a powerful tool to competitively inhibit miR-155, offering opportunities to study its impact on tumorigenic processes, including in hematological malignancies like chronic lymphocytic leukemia. This innovative technology provides a means to delve deeper into the regulation of miR-155 and its implications in cancer research and prognosis assessment.
Why choose mmu-miR-155-5p miRNA Agomir/Antagomir from AcceGen? Select MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir from AcceGen for enhanced durability, with a sustained impact lasting from a minimum of one week up to 5-6 weeks, setting them apart from standard miRNA mimics and inhibitors. These products are highly suitable for both in vitro and in vivo miRNA functional studies, ensuring long-lasting and reliable results in scientific investigations. | |||
Recommended Medium And Supplement | DEPC H2O | |||
Citation Guide | When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID). | |||
Label | FAM, CY3, CY5, etc. (optional) | |||
Application | For research use only | |||
Key Features | *cover all human, mouse, and rat miRNAs listed in miRBase | |||
Component | mmu-miR-155-5p Agomir and/or Antagomir (Product Form: Dry Powder) | |||
Product Type | microRNA Agomir/Antagomir | |||
Product Image | ![]() ![]() | |||
Tech Document | MIRacle™ Agomir Product Manual |
Related Products
- ONLINE INQUIRY
- PRODUCT REVIEWS
Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.