Home > Products > MicroRNA Agomir/Antagomir >

MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir

Product Name

MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir

Price Get Quote
Cat.No

AM3380

Species

Mouse

Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Description

MicroRNA: mmu-miR-155-5p

Accession Number: MIMAT0000165

Mature Sequence: UUAAUGCUAAUUGUGAUAGGGGU

 

mmu-miR-155-5p, comprising 23 nucleotides, is a microRNA predominantly present in Mus musculus. It is encoded by the MIR155 host gene (MIR155HG) and exhibits notable expression primarily in the thymus and spleen, with minimal to undetectable levels in other tissues under typical physiological conditions. MiR-155 exerts regulatory control over approximately 140 target genes, modulating the expression of various immunomodulatory, tumor-suppressor, and inflammation-related proteins. Distinguished as a proinflammatory and oncogenic miRNA, miR-155-5p is highly prevalent in activated B and T cells, as well as macrophages, where it plays a pivotal role in orchestrating lymphocyte and dendritic cell function, thus contributing significantly to overall immune homeostasis. In the context of the gastrointestinal tract, abnormal miR-155 expression is associated with Helicobacter pylori infection and is elevated in patients afflicted by inflammatory bowel disease (IBD) and colorectal cancer (CRC). This comprehensive understanding underscores miR-155-5p’s multifaceted involvement in various pathophysiological states, including cardiovascular disorders, inflammation, and cancer. Click here to browse detailed information about mmu-miR-155-5p in miRBase.

 

Introduction and application of mmu-miR-155-5p miRNA Agomir/Antagomir

The MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir holds significant promise in cancer research and prognosis assessment. MiR-155, which is found in high levels in various solid tumors and hematological malignancies, plays a critical role in promoting oncogenic features and is associated with poor prognosis in cancer patients. The miRNA Agomir in this context mimics and enhances the function of miR-155, potentially aiding in understanding its role in tumorigenesis and as an unfavorable prognosis indicator. Conversely, the miRNA Antagomir serves as a powerful tool to competitively inhibit miR-155, offering opportunities to study its impact on tumorigenic processes, including in hematological malignancies like chronic lymphocytic leukemia. This innovative technology provides a means to delve deeper into the regulation of miR-155 and its implications in cancer research and prognosis assessment.

 

Why choose mmu-miR-155-5p miRNA Agomir/Antagomir from AcceGen?

Select MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir from AcceGen for enhanced durability, with a sustained impact lasting from a minimum of one week up to 5-6 weeks, setting them apart from standard miRNA mimics and inhibitors. These products are highly suitable for both in vitro and in vivo miRNA functional studies, ensuring long-lasting and reliable results in scientific investigations.

Recommended Medium And Supplement
Citation Guide

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Label

FAM, CY3, CY5, etc. (optional)

Application

For research use only

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Component

mmu-miR-155-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Product Type

microRNA Agomir/Antagomir

Product Image AcceGen Frozen Cells & Cell Lines AcceGen Frozen Cells & Cell Lines
Tech Document

MIRacle™ Agomir Product Manual

MIRacle™ Antagomir Product Manual

MSDS-AcceGen MicroRNA Agomir

MSDS-AcceGen MicroRNA Antagomir

  • ONLINE INQUIRY
  • PRODUCT REVIEWS
We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time?

Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
Privacy Policy: AcceGen will never sell, rent, or share your personal information with any third parties without your express permission.
Reviews of MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir
AcceGen is always trying to do right by our customers and working hard to build a higher quality product.

Your email address will not be published.

AcceGen Scroll Top Button
Copy link
Powered by Social Snap