Explore Products
MicroRNA Agomir/Antagomir

MIRacle™ hsa-miR-429 miRNA Agomir/Antagomir

  • 187
MicroRNA: hsa-miR-429 Accession Number: MIMAT0001536 Mature Sequence: UAAUACUGUCUGGUAAAACCGU hsa-miR-429 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Species

Human

Cat.No

AM2278

Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Product Type

microRNA Agomir/Antagomir

Label

FAM, CY3, CY5, etc. (optional)

Component

hsa-miR-429 Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

MIRacle™ hsa-miR-429 miRNA Agomir/Antagomir
MIRacle™ hsa-miR-429 miRNA Agomir/Antagomir is a chemically modified synthetic oligonucleotide developed to precisely modulate the activity of endogenous microRNAs hsa-miR-429. The Agomir functions as a miRNA mimic, effectively enhancing the expression and biological activity of hsa-miR-429. Whereas the Antagomir serves as a sequence-specific antagonist, silencing hsa-miR-429’s activity. Both formulations are optimized for high stability and robust performance in in vitro and in vivo settings.

View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • AcceGen provides the MIRacle™ series in multiple specifications (2 OD, 4 OD, 50 OD) each HPLC-purified to ensure superior purity and experimental consistency. These reagents are ideal for investigating the role of hsa-miR-429 as a biomarker in cancer diagnosis, prognosis, and therapy targeting. hsa-miR-429 has been implicated in promoting tumorigenesis and cancer progression across various malignancies, including endometrial carcinoma and osteosarcoma, making this tool invaluable for cancer research and miRNA functional studies.

Frequently Asked Questions

  • What is hsa-miR-429 and what role does it play in cells?

    The hsa-miR-429 is a microRNA (miRNA) that regulates gene expression post-transcriptionally. It plays important roles in various cellular processes such as cell proliferation, differentiation, and epithelial-mesenchymal transition (EMT) in humans.

  • What are the potential applications of hsa-miR-429 Agomirs in research?

    The hsa-miR-429 Agomirs are valuable tools for studying the biological functions of hsa-miR-429 in various cellular contexts. Researchers can use them to investigate the role of hsa-miR-429 in disease processes such as cancer progression, fibrosis, and developmental disorders. They can also explore its potential as a therapeutic target.

  • How do hsa-miR-429 Antagomirs contribute to scientific studies?

    The hsa-miR-429 Antagomirs enable researchers to study the effects of reducing hsa-miR-429 levels. By inhibiting hsa-miR-429 function, Antagomirs provide insights into the biological consequences of hsa-miR-429 dysregulation, offering potential therapeutic strategies for diseases where hsa-miR-429 plays a critical role.

Inquiring MIRacle™ hsa-miR-429 miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

AcceGen Scroll Top Button