MicroRNA Agomir/Antagomir

MIRacle™ mmu-miR-135b-5p miRNA Agomir/Antagomir

  • 71
MicroRNA: mmu-miR-135b-5p Accession Number: MIMAT0000612 Mature Sequence: UAUGGCUUUUCAUUCCUAUGUGA mmu-miR-135b-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Species

Mouse

Cat.No

AM3581

Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Product Type

microRNA Agomir/Antagomir

Label

FAM, CY3, CY5, etc. (optional)

Component

mmu-miR-135b-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

Mmu-miR-135b-5p is a specific type of microRNA (miRNA) found in mice. MicroRNAs are small, single-stranded RNA molecules that play important roles in the post-transcriptional regulation of gene expression. Mmu-miR-135b-5p is derived from the precursor miRNA mmu-miR-135b, and its mature sequence is typically around 22 nucleotides in length.

MIRacle™ mmu-miR-135b-5p miRNA Agomir/Antagomir

 

MicroRNAs like mmu-miR-135b-5p function by binding to complementary sequences in the 3′ untranslated region (UTR) of target messenger RNA (mRNA) molecules, leading to the inhibition of protein translation or degradation of the mRNA. This regulatory process allows microRNAs to control the expression of genes involved in various biological processes, including development, differentiation, proliferation, apoptosis, and metabolism.

The specific targets and functions of mmu-miR-135b-5p may vary depending on the cellular context and physiological conditions. Research studies have implicated mmu-miR-135b-5p in various biological processes and disease pathways, including cancer, inflammation, neuronal development, and metabolic disorders. Additionally, dysregulation of mmu-miR-135b-5p expression has been associated with certain diseases and pathological conditions, highlighting its potential importance as a diagnostic or therapeutic target

 

Why choose MIRacle™ mmu-miR-135b-5p miRNA Agomir/Antagomir from AcceGen?

Synthesis Excellence

AcceGen boasts extensive experience in synthesizing MicroRNA Agomir/Antagomir, covering human, mouse, and rat miRNAs listed in the current miRBase.

 

Extended Stability

Our miRNA Agomir and Antagomir products outshine standard mimics and inhibitors, demonstrating enhanced resistance to degradation. Experience sustained effects lasting from a minimum of 1 week up to an impressive 5-6 weeks.

 

Versatile Applications

Employ these products seamlessly in in vitro or in vivo miRNA functional studies, unlocking new dimensions in your research endeavors.

View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • FOR RESEARCH USE ONLY

  •  

  • The role and functions of mmu-miR-135b-5p would need to be explored in the context of specific biological processes or diseases, as different microRNAs can have diverse roles in various cellular functions, including development, metabolism, and disease pathways.  Here are some potential applications:

  •  

  • Functional Studies

  • Investigating Gene Regulation: Studying the interactions between mmu-miR-135b-5p and specific target messenger RNAs (mRNAs) helps unravel the regulatory networks involved in gene expression.

  •  

  • Cellular Processes

  • Assessing the impact of mmu-miR-135b-5p on cellular functions, such as development, differentiation, apoptosis, and proliferation.

  •  

  • Cancer Studies

  • Exploring the involvement of mmu-miR-135b-5p in cancer-related pathways, considering its role in cell growth, differentiation, and apoptosis. This can contribute to cancer diagnostics and therapeutic development.

  •  

  • Cardiovascular Research

  • Investigating the potential role of mmu-miR-135b-5p in cardiovascular diseases, as microRNAs often participate in the regulation of cardiovascular-related genes.

  • Therapeutic Development:

  •  

  • Target for Therapeutics

  • Understanding the functions of mmu-miR-135b-5p may identify it as a potential therapeutic target for modulating specific cellular processes or treating diseases.

  •  

  • miRNA-based Therapies:

  • Exploring the use of mmu-miR-135b-5p mimics or inhibitors in miRNA-based therapies for diseases where its dysregulation is implicated.

  •  

  • In Vivo and In Vitro Studies

  • Animal Models: Using mmu-miR-135b-5p Agomir/Antagomir in mouse models to investigate the in vivo effects, providing insights into the physiological relevance of this miRNA.

  •  

  • Cell Culture Experiment

  • Employing mmu-miR-135b-5p in in vitro experiments to elucidate its role in specific cellular pathways or processes.

  •  

  • Molecular Biology Techniques

  • Reporter Assays: Utilizing mmu-miR-135b-5p in reporter assays to validate its interactions with specific target genes.

  • PCR and Western Blot Analysis: Investigating changes in mRNA and protein expression levels in response to mmu-miR-135b-5p modulation.

Inquiring MIRacle™ mmu-miR-135b-5p miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

AcceGen Scroll Top Button