Explore Products
MicroRNA Agomir/Antagomir

MIRacle™ mmu-miR-568 miRNA Agomir/Antagomir

  • 135
MicroRNA: mmu-miR-568 Accession Number: MIMAT0004892 Mature Sequence: AUGUAUAAAUGUAUACACAC mmu-miR-568 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Species

Mouse

Cat.No

AM4233

Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Product Type

microRNA Agomir/Antagomir

Label

FAM, CY3, CY5, etc. (optional)

Component

mmu-miR-568 Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

MIRacle™ mmu-miR-568 miRNA Agomir/Antagomir
MIRacle™ mmu-miR-568 miRNA Agomir/Antagomir is a chemically modified synthetic oligonucleotide developed to precisely modulate the activity of endogenous microRNAs. The Agomir functions as a miRNA mimic, effectively enhancing the expression and biological activity of mmu-miR-568. Whereas the Antagomir serves as a sequence-specific antagonist, inhibiting mmu-miR-568 function. Both formulations are optimized for high stability and efficacy in in vitro and in vivo settings.

View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • AcceGen provides the MIRacle™ series in multiple specifications (2 OD, 4 OD, 50 OD) with HPLC purification to accommodate a diverse range of experimental requirements. These reagents are ideal for investigating the role of mmu-miR-568 in colorectal cancer progression.

Inquiring MIRacle™ mmu-miR-568 miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

AcceGen Scroll Top Button