Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.
Species | Mouse |
Cat.No | AM4233 |
Product Category | MicroRNA Agomir/Antagomir |
Size/Quantity | 2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug) |
Shipping Info | Room Temperature |
Storage | -20°C / -80°C |
Product Type | microRNA Agomir/Antagomir |
Label | FAM, CY3, CY5, etc. (optional) |
Component | mmu-miR-568 Agomir and/or Antagomir (Product Form: Dry Powder) |
Key Features | *cover all human, mouse, and rat miRNAs listed in miRBase |
MicroRNA: mmu-miR-568
Accession Number: MIMAT0004892
Mature Sequence: AUGUAUAAAUGUAUACACAC
mmu-miR-568, a 20-nucleotide-long microRNA found in Mus musculus, emerges as a crucial regulator in cellular homeostasis. mmu-miR-568 exerts notable inhibition on the levels of claudin-1, ZO-1, E-cadherin, and phosphorylated STAT3 protein, and leads to the restraint of MODE-K cell proliferation. Its regulatory role extends to the modulation of tight junction (TJ) expression through direct interaction with the 3’-UTR of claudin-1 mRNA. Intriguingly, its upregulation in colitis mice induced by Dextran sulfate sodium (DSS) is mitigated by IL-22 treatment. The well-conserved precursor of mmu-miR-568 suggests its presence in other genomes, while its expression finds amelioration through antioxidant SFN. Click here to browse detailed information about mmu-miR-568 in miRBase.
Introduction to mmu-miR-568 miRNA Agomir/Antagomir and the application
The application of mmu-miR-568 Agomir or Antagomir holds promise as a potential therapeutic avenue for disorders involving tight junction dysregulation. Utilizing Agomir could enhance mmu-miR-568 expression, potentially ameliorating tight junction-related pathologies, while Antagomir could be employed to selectively suppress mmu-miR-568 expression, offering a strategy to counteract its effects in certain diseases or conditions.
Why choose mmu-miR-568 miRNA Agomir/Antagomir from AcceGen?
When considering your options, MIRacle™ mmu-miR-568 miRNA Agomir/Antagomir from AcceGen stands out due to their well-established proficiency in MicroRNA services. Notably, our products offer prolonged stability lasting from 1 week up to 5-6 weeks, making them highly suitable for in vitro and in vivo miRNA functional studies.
When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).
For research use only