MicroRNA Agomir/Antagomir

MIRacle™ mmu-miR-568 miRNA Agomir/Antagomir

  • 109
MicroRNA: mmu-miR-568 Accession Number: MIMAT0004892 Mature Sequence: AUGUAUAAAUGUAUACACAC mmu-miR-568 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Species

Mouse

Cat.No

AM4233

Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Product Type

microRNA Agomir/Antagomir

Label

FAM, CY3, CY5, etc. (optional)

Component

mmu-miR-568 Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

MicroRNA: mmu-miR-568

Accession Number: MIMAT0004892

Mature Sequence: AUGUAUAAAUGUAUACACAC

 

MIRacle™ mmu-miR-568 miRNA Agomir/Antagomirmmu-miR-568, a 20-nucleotide-long microRNA found in Mus musculus, emerges as a crucial regulator in cellular homeostasis. mmu-miR-568 exerts notable inhibition on the levels of claudin-1, ZO-1, E-cadherin, and phosphorylated STAT3 protein, and leads to the restraint of MODE-K cell proliferation. Its regulatory role extends to the modulation of tight junction (TJ) expression through direct interaction with the 3’-UTR of claudin-1 mRNA. Intriguingly, its upregulation in colitis mice induced by Dextran sulfate sodium (DSS) is mitigated by IL-22 treatment. The well-conserved precursor of mmu-miR-568 suggests its presence in other genomes, while its expression finds amelioration through antioxidant SFN. Click here to browse detailed information about mmu-miR-568 in miRBase.

 

Introduction to mmu-miR-568 miRNA Agomir/Antagomir and the application

The application of mmu-miR-568 Agomir or Antagomir holds promise as a potential therapeutic avenue for disorders involving tight junction dysregulation. Utilizing Agomir could enhance mmu-miR-568 expression, potentially ameliorating tight junction-related pathologies, while Antagomir could be employed to selectively suppress mmu-miR-568 expression, offering a strategy to counteract its effects in certain diseases or conditions.

 

Why choose mmu-miR-568 miRNA Agomir/Antagomir from AcceGen?

When considering your options, MIRacle™ mmu-miR-568 miRNA Agomir/Antagomir from AcceGen stands out due to their well-established proficiency in MicroRNA services. Notably, our products offer prolonged stability lasting from 1 week up to 5-6 weeks, making them highly suitable for in vitro and in vivo miRNA functional studies.

View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • For research use only

Inquiring MIRacle™ mmu-miR-568 miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

AcceGen Scroll Top Button