+1 862-686-2696
Featured Products
Primary Cells
Immortalized Cell Lines
Stem Cells
Tumor Cell Lines
Transfected Stable Cell Lines
Exosomes
MicroRNA Agomir/Antagomir
Nucleic Acid Kits
Explore Products
Cell
Cell
MicroRNA
MicroRNA
Test and Analysis
Test and Analysis
MicroRNA Agomir/Antagomir

MIRacle™ rno-miR-194-5p miRNA Agomir/Antagomir

  • 99
MicroRNA: rno-miR-194-5p Accession Number: MIMAT0000869 Mature Sequence UGUAACAGCAACUCCAUGUGGA rno-miR-194-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Home | MicroRNA Agomir/Antagomir | Rat MicroRNA Agomir/Antagomir | MIRacle™ rno-miR-194-5p miRNA Agomir/Antagomir
Species

Rat
Cat.No

AM5043
Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)
Shipping Info

Room Temperature
Storage

-20°C / -80°C
Product Type

microRNA Agomir/Antagomir
Label

FAM, CY3, CY5, etc. (optional)
Component

rno-miR-194-5p Agomir/Antagomir Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)
Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

MIRacle™ rno-miR-194-5p miRNA Agomir/Antagomir is a chemically modified synthetic oligonucleotide developed to precisely modulate the activity of endogenous microRNAs. The Agomir functions as a miRNA mimic, effectively enhancing the expression and biological activity of rno-miR-194-5p. Whereas the Antagomir serves as a sequence-specific antagonist, inhibiting rno-miR-194-5p function. Both formulations are optimized for high stability and efficacy in in vitro and in vivo settings.
AcceGen provides the MIRacle™ series in multiple specifications (2 OD, 4 OD, 50 OD) with HPLC purification to accommodate a diverse range of experimental requirements. These reagents are ideal for investigating the role of target miRNA in key biological processes including neuronal cell death, ischemic tolerance, and the regulation of neuroprotective pathways via SUMO2 modulation.

AcceGen Frozen Cells & Cell Lines
View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • MIRacle™ rno-miR-194-5p miRNA Agomir/Antagomir can be used to study the mechanism of cancers such as pancreatic cancer and skin squamous cell carcinoma, providing new strategies for disease treatment. It can also be used as the disease diagnostic marker.

  • Online Inquiry
  • Product Reviews

Inquiring MIRacle™ rno-miR-194-5p miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

Let's Advance Life Science Research Together

Contact Us
AcceGen Scroll Top Button