+1 862-686-2696

  • Ready-to-Use Models. Faster Immunotherapy Research. | Save Up to 25%

    Learn More
Featured Products
Primary Cells
Immortalized Cell Lines
Stem Cells
Tumor Cell Lines
Transfected Stable Cell Lines
Exosomes
MicroRNA Agomir/Antagomir
Cell Culture Media, Kits & Reagents
Explore Products
Cell
Cell
MicroRNA
MicroRNA
Test and Analysis
Test and Analysis
MicroRNA Agomir/Antagomir

MIRacle™ rno-miR-92a-3p miRNA Agomir/Antagomir

  • For research use only

Cat No.

AM4657
Product Type

microRNA Agomir/Antagomir
Component

rno-miR-92a-3p Agomir/Antagomir Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)
Species

Rat
Shipping Info

Room Temperature
Label

FAM, CY3, CY5, etc. (optional)
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)
Storage

-20°C / -80°C

rno-miR-92a-3p MicroRNA Agomir/Antagomir, advanced products of rno-miR-92a-3p MicroRNA Mimic/Inhibitor.

Product Image
  • MIRacle™ rno-miR-92a-3p miRNA Agomir/Antagomir
Get a Quote
Home | MicroRNA Agomir/Antagomir | Rat MicroRNA Agomir/Antagomir | MIRacle™ rno-miR-92a-3p miRNA Agomir/Antagomir

Description

MicroRNA: rno-miR-92a-3p

Accession Number: MIMAT0000816
Mature Sequence UAUUGCACUUGUCCCGGCCUG
rno-miR-92a-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-92a-3p in miRBase.

What is MicroRNA Agomir/Antagomir?

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

Why choose rno-miR-92a-3p miRNA Agomir/Antagomir from AcceGen?

AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Species

Rat
Cat.No

AM4657
Product Category

MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)
Shipping Info

Room Temperature
Storage

-20°C / -80°C
Product Type

microRNA Agomir/Antagomir
Label

FAM, CY3, CY5, etc. (optional)
Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time
Component

rno-miR-92a-3p Agomir/Antagomir Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Citation

When you publish your research, please cite our product as "AcceGen Biotech Cat.# XXX-0000". In return, we’ ll give you a $200 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Frequently Asked Questions

  • What are the sequence, molecular weight, and chemical modifications of the MIRacle™ rno-miR-92a-3p miRNA Antagomir?

    Sequence (based on mature miRNA):
    UAUUGCACUUGUCCCGGCCUG

    Chemical modifications:
    The antagomir is chemically modified to enhance stability and cellular uptake, including:

    Full-length 2′-O-methyl nucleotide modification

    2 phosphorothioate modifications at the 5′ end

    4 phosphorothioate modifications near the 3′ end

    Cholesterol conjugation at the 3′ end

    These modifications significantly improve stability, cellular uptake, and regulatory activity, making the antagomir suitable for both in vitro and in vivo miRNA functional studies.

    Approximate molecular weight:
    ~ 7.4 kDa

  • What is a suitable negative control for the antagomir?

    A suitable negative control is:
    AM02 miRNA Antagomir Negative Control
    Available size: 10 nmol
    Lead time: 4–6 weeks

  • Are qPCR or gel electrophoresis validation reports available?

    Both rno-miR-92a-3p antagomir and the negative control are custom-synthesized products. Validation information (e.g., quality control results such as qPCR or electrophoresis analysis) will be included in the final synthesis report provided with the product.

  • IIs this product suitable for in vivo rat studies?

    Yes. MIRacle™ Antagomirs are designed for both in vitro and in vivo applications, and the chemical modifications improve stability and delivery efficiency in animal models, making them suitable for in vivo rat studies.

  • Which stem-loop precursor does rno-miR-92a-3p originate from (rno-miR-92a-1 or rno-miR-92a-2)?

    Yes. MIRacle™ Antagomirs are designed for both in vitro and in vivo applications, and the chemical modifications improve stability and delivery efficiency in animal models, making them suitable for in vivo rat studies.

  • Online Inquiry
  • Product Reviews

Inquiring MIRacle™ rno-miR-92a-3p miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

Let's Advance Life Science Research Together

Contact Us
AcceGen Scroll Top Button