• Boost Your Research with FREE Freezing Medium

MicroRNA Agomir/Antagomir

MIRacle™ rno-miR-425-5p miRNA Agomir/Antagomir

  • For research use only

Cat No.

AM5013

Product Type

microRNA Agomir/Antagomir

Component

rno-miR-425-5p Agomir/Antagomir Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Species

Rat

Shipping Info

Room Temperature

Label

FAM, CY3, CY5, etc. (optional)

Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Storage

-20°C / -80°C

rno-miR-425-5p MicroRNA Agomir/Antagomir, advanced products of rno-miR-425-5p MicroRNA Mimic/Inhibitor.

Product Image

Description

MicroRNA: rno-miR-425-5p

Accession Number: MIMAT0005314
Mature Sequence AAUGACACGAUCACUCCCGUUGA
rno-miR-425-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-425-5p in miRBase.

What is MicroRNA Agomir/Antagomir?

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

Why choose rno-miR-425-5p miRNA Agomir/Antagomir from AcceGen?

AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Species

Rat

Cat.No

AM5013

Product Category

MicroRNA Agomir/Antagomir

Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Product Type

microRNA Agomir/Antagomir

Label

FAM, CY3, CY5, etc. (optional)

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Component

rno-miR-425-5p Agomir/Antagomir Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Citation

When you publish your research, please cite our product as "AcceGen Biotech Cat.# XXX-0000". In return, we’ ll give you a $200 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Inquiring MIRacle™ rno-miR-425-5p miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

AcceGen Scroll Top Button