Explore Products
MicroRNA Agomir/Antagomir

MIRacle™ hsa-miR-653-5p miRNA Agomir/Antagomir

  • 181
MicroRNA: hsa-miR-653-5p Accession Number: MIMAT0003328 Mature Sequence: GUGUUGAAACAAUCUCUACUG hsa-miR-653-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Species

Human

Cat.No

AM2481

Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Product Type

microRNA Agomir/Antagomir

Label

FAM, CY3, CY5, etc. (optional)

Component

hsa-miR-653-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

MIRacle™ hsa-miR-653-5p miRNA Agomir/AntagomirMIRacle™ hsa-miR-653-5p miRNA Agomir/Antagomir is a chemically modified synthetic oligonucleotide developed to precisely modulate the activity of endogenous microRNAs. The Agomir functions as a miRNA mimic, effectively enhancing the expression and biological activity of hsa-miR-653-5p. Whereas the Antagomir serves as a sequence-specific antagonist, inhibiting hsa-miR-653-5p function. Both formulations are optimized for high stability and efficacy in in vitro and in vivo settings. AcceGen provides the MIRacle™ series in multiple specifications (2 OD, 4 OD, 50 OD) with HPLC purification to accommodate a diverse range of experimental requirements. These reagents are ideal for exploring the biological functions of hsa-miR-653-5p in disease contexts such as prostate cancer metastasis, osteoarthritis progression via chondrocyte senescence regulation, and breast cancer suppression.

View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • MIRacle™ hsa-miR-653-5p Agomir and Antagomir are optimized tools for modulating miR-653-5p activity with high stability and cellular uptake. The Agomir mimics endogenous miR-653-5p, enhancing its function, while the Antagomir binds complementarily to inhibit it. These reagents are ideal for studying miR-653-5p’s role in regulating EMT, apoptosis, and inflammatory pathways. Relevant disease contexts include prostate cancer metastasis, breast cancer suppression, and osteoarthritis via chondrocyte senescence. Their versatility in both in vitro and in vivo applications makes them essential for functional miRNA studies.

Inquiring MIRacle™ hsa-miR-653-5p miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

AcceGen Scroll Top Button