+1 862-686-2696
Featured Products
Primary Cells
Immortalized Cell Lines
Stem Cells
Tumor Cell Lines
Transfected Stable Cell Lines
Exosomes
MicroRNA Agomir/Antagomir
Nucleic Acid Kits
Explore Products
Cell
Cell
MicroRNA
MicroRNA
Test and Analysis
Test and Analysis
MicroRNA Agomir/Antagomir

MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir

  • 170
MicroRNA: mmu-miR-155-5p Accession Number: MIMAT0000165 Mature Sequence: UUAAUGCUAAUUGUGAUAGGGGU mmu-miR-155-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Home | MicroRNA Agomir/Antagomir | Mouse MicroRNA Agomir/Antagomir | MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir
Species

Mouse
Cat.No

AM3380
Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)
Shipping Info

Room Temperature
Storage

-20°C / -80°C
Product Type

microRNA Agomir/Antagomir
Label

FAM, CY3, CY5, etc. (optional)
Component

mmu-miR-155-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)
Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

MIRacle™ mmu-miR-155-5p miRNA Agomir/AntagomirMIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir is a chemically modified synthetic oligonucleotide developed to precisely modulate the activity of endogenous microRNAs. The Agomir functions as a miRNA mimic, effectively enhancing the expression and biological activity of mmu-miR-155-5p. Whereas the Antagomir serves as a sequence-specific antagonist, inhibiting mmu-miR-155-5p function. Both formulations are optimized for high stability and efficacy in in vitro and in vivo settings.

AcceGen Frozen Cells & Cell Lines
View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • AcceGen provides the MIRacle™ series in multiple specifications (2 OD, 4 OD, 50 OD) with HPLC purification to accommodate a diverse range of experimental requirements. These reagents are ideal for investigating the role of target miRNA in key biological processes including gastric cancer progression and promotion of angiogenesis.

Frequently Asked Questions

  • What is the primary function of mmu-miR-155-5p miRNA Agomir in research?

    It is used to increase the activity of mmu-miR-155-5p, helping to study its effects on gene regulation.

  • What is mmu-miR-155-5p miRNA Antagomir designed to do in experiments?

    The Antagomir is designed to inhibit mmu-miR-155-5p, allowing researchers to assess its role by blocking its function.

  • In which types of studies is mmu-miR-155-5p Agomir commonly used?

    It is often used in studies of immune function, cancer, and inflammation to understand miRNA’s role.

  • Can mmu-miR-155-5p Antagomir be used in both in vitro and in vivo experiments?

    Yes, the Antagomir is suitable for use in both cell culture (in vitro) and live animal studies (in vivo).

  • Online Inquiry
  • Product Reviews

Inquiring MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

Let's Advance Life Science Research Together

Contact Us
AcceGen Scroll Top Button