Explore Products
MicroRNA Agomir/Antagomir

MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir

  • 156
MicroRNA: mmu-miR-155-5p Accession Number: MIMAT0000165 Mature Sequence: UUAAUGCUAAUUGUGAUAGGGGU mmu-miR-155-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Species

Mouse

Cat.No

AM3380

Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Product Type

microRNA Agomir/Antagomir

Label

FAM, CY3, CY5, etc. (optional)

Component

mmu-miR-155-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

MicroRNA: mmu-miR-155-5p

Accession Number: MIMAT0000165

Mature Sequence: UUAAUGCUAAUUGUGAUAGGGGU

 

MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomirmmu-miR-155-5p, comprising 23 nucleotides, is a microRNA predominantly present in Mus musculus. It is encoded by the MIR155 host gene (MIR155HG) and exhibits notable expression primarily in the thymus and spleen, with minimal to undetectable levels in other tissues under typical physiological conditions. MiR-155 exerts regulatory control over approximately 140 target genes, modulating the expression of various immunomodulatory, tumor-suppressor, and inflammation-related proteins. Distinguished as a proinflammatory and oncogenic miRNA, miR-155-5p is highly prevalent in activated B and T cells, as well as macrophages, where it plays a pivotal role in orchestrating lymphocyte and dendritic cell function, thus contributing significantly to overall immune homeostasis. In the context of the gastrointestinal tract, abnormal miR-155 expression is associated with Helicobacter pylori infection and is elevated in patients afflicted by inflammatory bowel disease (IBD) and colorectal cancer (CRC). This comprehensive understanding underscores miR-155-5p’s multifaceted involvement in various pathophysiological states, including cardiovascular disorders, inflammation, and cancer. Click here to browse detailed information about mmu-miR-155-5p in miRBase.

 

Introduction and application of mmu-miR-155-5p miRNA Agomir/Antagomir

The MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir holds significant promise in cancer research and prognosis assessment. MiR-155, which is found in high levels in various solid tumors and hematological malignancies, plays a critical role in promoting oncogenic features and is associated with poor prognosis in cancer patients. The miRNA Agomir in this context mimics and enhances the function of miR-155, potentially aiding in understanding its role in tumorigenesis and as an unfavorable prognosis indicator. Conversely, the miRNA Antagomir serves as a powerful tool to competitively inhibit miR-155, offering opportunities to study its impact on tumorigenic processes, including in hematological malignancies like chronic lymphocytic leukemia. This innovative technology provides a means to delve deeper into the regulation of miR-155 and its implications in cancer research and prognosis assessment.

 

Why choose mmu-miR-155-5p miRNA Agomir/Antagomir from AcceGen?

Select MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir from AcceGen for enhanced durability, with a sustained impact lasting from a minimum of one week up to 5-6 weeks, setting them apart from standard miRNA mimics and inhibitors. These products are highly suitable for both in vitro and in vivo miRNA functional studies, ensuring long-lasting and reliable results in scientific investigations.

View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • For research use only

Frequently Asked Questions

  • What is the primary function of mmu-miR-155-5p miRNA Agomir in research?

    It is used to increase the activity of mmu-miR-155-5p, helping to study its effects on gene regulation.

  • What is mmu-miR-155-5p miRNA Antagomir designed to do in experiments?

    The Antagomir is designed to inhibit mmu-miR-155-5p, allowing researchers to assess its role by blocking its function.

  • In which types of studies is mmu-miR-155-5p Agomir commonly used?

    It is often used in studies of immune function, cancer, and inflammation to understand miRNA’s role.

  • Can mmu-miR-155-5p Antagomir be used in both in vitro and in vivo experiments?

    Yes, the Antagomir is suitable for use in both cell culture (in vitro) and live animal studies (in vivo).

Inquiring MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

AcceGen Scroll Top Button