Home > Products > Rat miRNA Agomir/Antagomir >

MIRacle™ rno-miR-489-3p miRNA Agomir/Antagomir

Image AcceGen cells & cell lines
Product Name

MIRacle™ rno-miR-489-3p miRNA Agomir/Antagomir

Cat.No

AM5187

Species

Rat

Size/Quantity

2 OD, 4 OD, 50 OD(size by request)

Shipping Info

Ice pack

Storage

-20°C

Description

Accession Number: MIMAT0003113
Mature Sequence AUGACAUCACAUAUAUGGCAGC
rno-miR-489-3p are small non-coding RNAs of 20–22 nucleotides, typically excised from 60–110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression.
AcceGen Biotech has extended experience in agomir/antagomir synthesis services that cover all human, mouse and rat miRNAs in the current miRbase. Compared to standard miRNA mimics and inhibitors, agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.
Deliverables: Agomir and/or antagomir, DEPC H2O.
1 OD corresponds to 33 ug.

Label

FAM, CY3

Application

For research use only

Citation Guide

If the product is used for publication, it should be cited in the publication as: “AcceGen Biotech Cat.# XXX-0000”. In addition, click here to submit your paper’s PubMed ID (PMID) to get a $100 coupon.

Product Type

microRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time?

Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
AcceGen inquiry form verification code
Privacy Policy: AcceGen will never sell, rent, or share your personal information with any third parties without your express permission.
AcceGen Scroll Top Button