Home > Products > Rat MicroRNA Agomir/Antagomir >

MIRacle™ rno-miR-194-5p miRNA Agomir/Antagomir

Product Name

MIRacle™ rno-miR-194-5p miRNA Agomir/Antagomir

Price Get Quote
Cat.No

AM5043

Species

Rat

Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Description

MicroRNA: rno-miR-194-5p

Accession Number: MIMAT0000869
Mature Sequence: UGUAACAGCAACUCCAUGUGGA
Rno-microRNA-194-5p (rno-miR-194-5p) are a rat microRNA. It is a mature miRNA formed from the 5′ end of rat miR-194 stem-loop after being cleaved by the Dicer enzyme.

MiR-194-5p is a regulator of many diseases, it has potential anti-inflammatory and anti-cancer effects. And miR-194-5p can also inhibits ischemia-induced cardiomyocyte injury. Besides, there are also publications that discovered the mechanism by which miR-194-5p can interact with some lncRNAs.

MicroRNAs (miRNA) can participate in the regulation of related physiological and pathological processes by inhibiting the expression of associated genes.

Click here to browse detailed information about rno-miR-194-5p in miRBase.

 

Introduction and Applications of miRNA Agomir/Antagomir

MiRNA agomir is a kind of chemically modified miRNA mimic. In the antisense strand, 3’ terminal is modified by cholesterol, there are two thiol modifications in the 5’-terminal, four thiol modifications in the 3’-terminal, and the whole strand is modified by OMe. Agomir can mimic the function of endogenous miRNAs in actual physiological activities.

MiRNA antagomir is a kind of chemically modified miRNA antagonist. 3’-terminal is modified by cholesterol, there are two thiol modifications in the 5’-terminal, four thiol modifications in the 3’-terminal, and the whole strand is modified by 2’-OMe. Antagomir can block the physiological function of endogenous mature miRNA through a competitive inhibition mechanism.

Agomir and antagomir are usually used in in vivo experiments in animal models and can be administered by tail vein injection and gavage. Agomir and antagomir can also be applied to experiments in vitro cell models, and cell transfection is an effective treatment method.

 

Why choose rno-miR-194-5p miRNA Agomir/Antagomir from AcceGen?

AcceGen can provide mature and high-quality miRNA agomir/antagomir synthesis services. The product line covers many typical species, including human, mouse, and rat.

In addition, AcceGen provides optional fluorescent dyes to label additional modified agomir/antagomir products to help researchers design more complete experimental protocols.

Recommended Medium And Supplement
Citation Guide

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Label

FAM, CY3, CY5, etc. (optional)

Application

For research use only

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Component

rno-miR-194-5p Agomir/Antagomir Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Product Type

microRNA Agomir/Antagomir

Product Image AcceGen Frozen Cells & Cell Lines AcceGen Frozen Cells & Cell Lines
Tech Document

MIRacle™ Agomir Product Manual

MIRacle™ Antagomir Product Manual

MSDS-AcceGen MicroRNA Agomir

MSDS-AcceGen MicroRNA Antagomir

  • ONLINE INQUIRY
  • PRODUCT REVIEWS
We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time?

Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
Privacy Policy: AcceGen will never sell, rent, or share your personal information with any third parties without your express permission.
Reviews of MIRacle™ rno-miR-194-5p miRNA Agomir/Antagomir
AcceGen is always trying to do right by our customers and working hard to build a higher quality product.

Your email address will not be published.

AcceGen Scroll Top Button
Copy link
Powered by Social Snap