Dear AcceGen Customers,

Due to the recent COVID-19 pandemic, order shipment, processing times, and company hours may be affected. However, we are trying our best to provide high-quality products and services as usual. Thank you for your patience and continuous support. The health and safety of our customers and employees is always the highest priority for us. Need any support? Contact us at [email protected].
X

Home > Products > MicroRNA Agomir/Antagomir >

MicroRNA Agomir/Antagomir

AcceGen MicroRNA Agomir/Antagomir

MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.

MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

NOMENCLATURE

  • 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
  • 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
  • 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
  • 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.

AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to pave new ways to meet all your needs.

Cat.#NameDescriptionPrice

AM5074

MIRacle™ rno-miR-28-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0004716 Mature Sequence CACUAGAUUGUGAGCUCCUGGA rno-miR-28-3p are small non-...more +inquiry

AM5073

MIRacle™ rno-miR-350 miRNA Agomir/Antagomir

Accession Number: MIMAT0000604 Mature Sequence UUCACAAAGCCCAUACACUUUCAC rno-miR-350 are small non-...more +inquiry

AM5072

MIRacle™ rno-miR-3084c-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0035744 Mature Sequence CUGCCAGUUCCCUUCAGACAA rno-miR-3084c-3p are small no...more +inquiry

AM5071

MIRacle™ rno-miR-1839-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0024844 Mature Sequence AGACCUACUUAUCUACCAACAG rno-miR-1839-3p are small no...more +inquiry

AM5070

MIRacle™ rno-miR-3564 miRNA Agomir/Antagomir

Accession Number: MIMAT0017837 Mature Sequence UGGGAAAUGCAAAGAGGGAAG rno-miR-3564 are small non-co...more +inquiry

AM5069

MIRacle™ rno-miR-675-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017363 Mature Sequence UGUAUGCCCUAACCGCUCAGU rno-miR-675-3p are small non-...more +inquiry

AM5068

MIRacle™ rno-miR-455-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017308 Mature Sequence GCAGUCCACGGGCAUAUACACU rno-miR-455-3p are small non...more +inquiry

AM5067

MIRacle™ rno-miR-363-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0003209 Mature Sequence CGGGUGGAUCACGAUGCAAUUU rno-miR-363-5p are small non...more +inquiry

AM5066

MIRacle™ rno-miR-449a-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017181 Mature Sequence CAGCUAACAUGCAACUGCUCUC rno-miR-449a-3p are small no...more +inquiry

AM5065

MIRacle™ rno-miR-195-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0000870 Mature Sequence UAGCAGCACAGAAAUAUUGGC rno-miR-195-5p are small non-...more +inquiry

AM5064

MIRacle™ rno-miR-128-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0000834 Mature Sequence UCACAGUGAACCGGUCUCUUU rno-miR-128-3p are small non-...more +inquiry

AM5063

MIRacle™ rno-miR-28-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0000800 Mature Sequence AAGGAGCUCACAGUCUAUUGAG rno-miR-28-5p are small non-...more +inquiry

AM5062

MIRacle™ rno-miR-20a-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0000603 Mature Sequence ACUGCAUUACGAGCACUUACA rno-miR-20a-3p are small non-...more +inquiry

AM5061

MIRacle™ rno-miR-3084c-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0035743 Mature Sequence GUUGAAGGUUAAUUAGCAGAG rno-miR-3084c-5p are small no...more +inquiry

AM5060

MIRacle™ rno-miR-1839-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0024843 Mature Sequence AAGGUAGAUAGAACAGGUCUUG rno-miR-1839-5p are small no...more +inquiry

AM5059

MIRacle™ rno-miR-9b-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017836 Mature Sequence AUACAGCUAGAUAACCAA rno-miR-9b-3p are small non-codi...more +inquiry

AM5058

MIRacle™ rno-miR-675-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0012841 Mature Sequence UGGUGCGGAAAGGGCCCACAGU rno-miR-675-5p are small non...more +inquiry

AM5057

MIRacle™ rno-miR-455-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0005316 Mature Sequence UAUGUGCCUUUGGACUACAUCG rno-miR-455-5p are small non...more +inquiry

AM5056

MIRacle™ rno-miR-374-3p miRNA Agomir/Antagomir

Accession Number: MIMAT0017223 Mature Sequence CUUAGCACGUUGUAUUAUUAUU rno-miR-374-3p are small non...more +inquiry

AM5055

MIRacle™ rno-miR-449a-5p miRNA Agomir/Antagomir

Accession Number: MIMAT0001543 Mature Sequence UGGCAGUGUAUUGUUAGCUGGU rno-miR-449a-5p are small no...more +inquiry
AcceGen Scroll Top Button