Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir
Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
Cat.# | Name | Description | Stock | Price |
---|---|---|---|---|
AM0154 | MIRacle™ hsa-miR-410-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-410-3p Accession Number: MIMAT0002171 Mature Sequence: AAUAUAACACAGAUGGCCUGU hsa-m...more | +inquiry | |
AM0153 | MIRacle™ hsa-miR-367-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-367-5p Accession Number: MIMAT0004686 Mature Sequence: ACUGUUGCUAAUAUGCAACUCU hsa-...more | +inquiry | |
AM0152 | MIRacle™ hsa-miR-144-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-144-5p Accession Number: MIMAT0004600 Mature Sequence: GGAUAUCAUCAUAUACUGUAAG hsa-...more | +inquiry | |
AM0151 | MIRacle™ hsa-miR-147a miRNA Agomir/Antagomir | MicroRNA: hsa-miR-147a Accession Number: MIMAT0000251 Mature Sequence: GUGUGUGGAAAUGCUUCUGC hsa-miR-...more | +inquiry | |
AM0150 | MIRacle™ hsa-miR-7159-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7159-5p Accession Number: MIMAT0028228 Mature Sequence: UUCAACAAGGGUGUAGGAUGG hsa-...more | +inquiry | |
AM0149 | MIRacle™ hsa-miR-6864-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6864-3p Accession Number: MIMAT0027629 Mature Sequence: GUGAGACUUCUCUCCCUUCAG hsa-...more | +inquiry | |
AM0148 | MIRacle™ hsa-miR-6814-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6814-3p Accession Number: MIMAT0027529 Mature Sequence: ACUCGCAUCCUUCCCUUGGCAG hsa...more | +inquiry | |
AM0147 | MIRacle™ hsa-miR-6764-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6764-3p Accession Number: MIMAT0027429 Mature Sequence: UCUCUGGUCUUUCCUUGACAG hsa-...more | +inquiry | |
AM0146 | MIRacle™ hsa-miR-6513-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6513-3p Accession Number: MIMAT0025483 Mature Sequence: UCAAGUGUCAUCUGUCCCUAG hsa-...more | +inquiry | |
AM0145 | MIRacle™ hsa-miR-5692c miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5692c Accession Number: MIMAT0022476 Mature Sequence: AAUAAUAUCACAGUAGGUGUAC hsa-m...more | +inquiry | |
AM0144 | MIRacle™ hsa-miR-5007-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5007-3p Accession Number: MIMAT0021036 Mature Sequence: AUCAUAUGAACCAAACUCUAAU hsa...more | +inquiry | |
AM0143 | MIRacle™ hsa-miR-4758-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4758-5p Accession Number: MIMAT0019903 Mature Sequence: GUGAGUGGGAGCCGGUGGGGCUG hs...more | +inquiry | |
AM0142 | MIRacle™ hsa-miR-4707-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4707-5p Accession Number: MIMAT0019807 Mature Sequence: GCCCCGGCGCGGGCGGGUUCUGG hs...more | +inquiry | |
AM0141 | MIRacle™ hsa-miR-4646-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4646-5p Accession Number: MIMAT0019707 Mature Sequence: ACUGGGAAGAGGAGCUGAGGGA hsa...more | +inquiry | |
AM0140 | MIRacle™ hsa-miR-4483 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4483 Accession Number: MIMAT0019017 Mature Sequence: GGGGUGGUCUGUUGUUG hsa-miR-448...more | +inquiry | |
AM0139 | MIRacle™ hsa-miR-548z miRNA Agomir/Antagomir | MicroRNA: hsa-miR-548z Accession Number: MIMAT0018446 Mature Sequence: CAAAAACCGCAAUUACUUUUGCA hsa-m...more | +inquiry | |
AM0138 | MIRacle™ hsa-miR-3664-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3664-5p Accession Number: MIMAT0018086 Mature Sequence: AACUCUGUCUUCACUCAUGAGU hsa...more | +inquiry | |
AM0137 | MIRacle™ hsa-miR-4258 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4258 Accession Number: MIMAT0016879 Mature Sequence: CCCCGCCACCGCCUUGG hsa-miR-425...more | +inquiry | |
AM0136 | MIRacle™ hsa-miR-3162-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3162-3p Accession Number: MIMAT0019213 Mature Sequence: UCCCUACCCCUCCACUCCCCA hsa-...more | +inquiry | |
AM0135 | MIRacle™ hsa-miR-2110 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-2110 Accession Number: MIMAT0010133 Mature Sequence: UUGGGGAAACGGCCGCUGAGUG hsa-mi...more | +inquiry |