Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir
Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
Cat.# | Name | Description | Stock | Price |
---|---|---|---|---|
AM0174 | MIRacle™ hsa-miR-6865-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6865-5p Accession Number: MIMAT0027630 Mature Sequence: UAGGUGGCAGAGGAGGGACUUCA hs...more | +inquiry | |
AM0173 | MIRacle™ hsa-miR-6815-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6815-5p Accession Number: MIMAT0027530 Mature Sequence: UAGGUGGCGCCGGAGGAGUCAUU hs...more | +inquiry | |
AM0172 | MIRacle™ hsa-miR-6765-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6765-5p Accession Number: MIMAT0027430 Mature Sequence: GUGAGGCGGGGCCAGGAGGGUGUGU ...more | +inquiry | |
AM0171 | MIRacle™ hsa-miR-6514-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6514-5p Accession Number: MIMAT0025484 Mature Sequence: UAUGGAGUGGACUUUCAGCUGGC hs...more | +inquiry | |
AM0170 | MIRacle™ hsa-miR-5687 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5687 Accession Number: MIMAT0022478 Mature Sequence: UUAGAACGUUUUAGGGUCAAAU hsa-mi...more | +inquiry | |
AM0169 | MIRacle™ hsa-miR-548ap-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-548ap-5p Accession Number: MIMAT0021037 Mature Sequence: AAAAGUAAUUGCGGUCUUU hsa-m...more | +inquiry | |
AM0168 | MIRacle™ hsa-miR-4758-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4758-3p Accession Number: MIMAT0019904 Mature Sequence: UGCCCCACCUGCUGACCACCCUC hs...more | +inquiry | |
AM0167 | MIRacle™ hsa-miR-4707-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4707-3p Accession Number: MIMAT0019808 Mature Sequence: AGCCCGCCCCAGCCGAGGUUCU hsa...more | +inquiry | |
AM0166 | MIRacle™ hsa-miR-4646-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4646-3p Accession Number: MIMAT0019708 Mature Sequence: AUUGUCCCUCUCCCUUCCCAG hsa-...more | +inquiry | |
AM0165 | MIRacle™ hsa-miR-4484 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4484 Accession Number: MIMAT0019018 Mature Sequence: AAAAGGCGGGAGAAGCCCCA hsa-miR-...more | +inquiry | |
AM0164 | MIRacle™ hsa-miR-548aa miRNA Agomir/Antagomir | MicroRNA: hsa-miR-548aa Accession Number: MIMAT0018447 Mature Sequence: AAAAACCACAAUUACUUUUGCACCA hs...more | +inquiry | |
AM0163 | MIRacle™ hsa-miR-3664-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3664-3p Accession Number: MIMAT0019220 Mature Sequence: UCUCAGGAGUAAAGACAGAGUU hsa...more | +inquiry | |
AM0162 | MIRacle™ hsa-miR-4259 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4259 Accession Number: MIMAT0016880 Mature Sequence: CAGUUGGGUCUAGGGGUCAGGA hsa-mi...more | +inquiry | |
AM0161 | MIRacle™ hsa-miR-3163 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3163 Accession Number: MIMAT0015037 Mature Sequence: UAUAAAAUGAGGGCAGUAAGAC hsa-mi...more | +inquiry | |
AM0160 | MIRacle™ hsa-miR-2114-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-2114-5p Accession Number: MIMAT0011156 Mature Sequence: UAGUCCCUUCCUUGAAGCGGUC hsa...more | +inquiry | |
AM0159 | MIRacle™ hsa-miR-1248 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1248 Accession Number: MIMAT0005900 Mature Sequence: ACCUUCUUGUAUAAGCACUGUGCUAAA h...more | +inquiry | |
AM0158 | MIRacle™ hsa-miR-374b-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-374b-3p Accession Number: MIMAT0004956 Mature Sequence: CUUAGCAGGUUGUAUUAUCAUU hsa...more | +inquiry | |
AM0157 | MIRacle™ hsa-miR-549a miRNA Agomir/Antagomir | MicroRNA: hsa-miR-549a Accession Number: MIMAT0003333 Mature Sequence: UGACAACUAUGGAUGAGCUCU hsa-miR...more | +inquiry | |
AM0156 | MIRacle™ hsa-miR-590-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-590-5p Accession Number: MIMAT0003258 Mature Sequence: GAGCUUAUUCAUAAAAGUGCAG hsa-...more | +inquiry | |
AM0155 | MIRacle™ hsa-miR-516a-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-516a-5p Accession Number: MIMAT0004770 Mature Sequence: UUCUCGAGGAAAGAAGCACUUUC hs...more | +inquiry |