Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir
Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM2274 | MIRacle™ hsa-miR-548bb-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-548bb-3p Accession Number: MIMAT0035704 Mature Sequence: CAAAAACCAUAGUUACUUUUGC hs...more | +inquiry | |
| AM2273 | MIRacle™ hsa-miR-7151-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7151-5p Accession Number: MIMAT0028212 Mature Sequence: GAUCCAUCUCUGCCUGUAUUGGC hs...more | +inquiry | |
| AM2272 | MIRacle™ hsa-miR-6855-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6855-3p Accession Number: MIMAT0027611 Mature Sequence: AGACUGACCUUCAACCCCACAG hsa...more | +inquiry | |
| AM2271 | MIRacle™ hsa-miR-6805-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6805-3p Accession Number: MIMAT0027511 Mature Sequence: UUGCUCUGCUCCCCCGCCCCCAG hs...more | +inquiry | |
| AM2270 | MIRacle™ hsa-miR-6755-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6755-3p Accession Number: MIMAT0027411 Mature Sequence: UGUUGUCAUGUUUUUUCCCUAG hsa...more | +inquiry | |
| AM2269 | MIRacle™ hsa-miR-6504-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6504-3p Accession Number: MIMAT0025465 Mature Sequence: CAUUACAGCACAGCCAUUCU hsa-m...more | +inquiry | |
| AM2268 | MIRacle™ hsa-miR-5588-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5588-5p Accession Number: MIMAT0022295 Mature Sequence: ACUGGCAUUAGUGGGACUUUU hsa-...more | +inquiry | |
| AM2267 | MIRacle™ hsa-miR-4804-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4804-3p Accession Number: MIMAT0019985 Mature Sequence: UGCUUAACCUUGCCCUCGAAA hsa-...more | +inquiry | |
| AM2266 | MIRacle™ hsa-miR-4749-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4749-3p Accession Number: MIMAT0019886 Mature Sequence: CGCCCCUCCUGCCCCCACAG hsa-m...more | +inquiry | |
| AM2265 | MIRacle™ hsa-miR-4695-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4695-5p Accession Number: MIMAT0019788 Mature Sequence: CAGGAGGCAGUGGGCGAGCAGG hsa...more | +inquiry | |
| AM2264 | MIRacle™ hsa-miR-4633-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4633-5p Accession Number: MIMAT0019689 Mature Sequence: AUAUGCCUGGCUAGCUCCUC hsa-m...more | +inquiry | |
| AM2263 | MIRacle™ hsa-miR-4474-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4474-5p Accession Number: MIMAT0019234 Mature Sequence: UUAGUCUCAUGAUCAGACACA hsa-...more | +inquiry | |
| AM2262 | MIRacle™ hsa-miR-3938 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3938 Accession Number: MIMAT0018353 Mature Sequence: AAUUCCCUUGUAGAUAACCCGG hsa-mi...more | +inquiry | |
| AM2261 | MIRacle™ hsa-miR-3649 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3649 Accession Number: MIMAT0018069 Mature Sequence: AGGGACCUGAGUGUCUAAG hsa-miR-3...more | +inquiry | |
| AM2260 | MIRacle™ hsa-miR-4308 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4308 Accession Number: MIMAT0016861 Mature Sequence: UCCCUGGAGUUUCUUCUU hsa-miR-43...more | +inquiry | |
| AM2259 | MIRacle™ hsa-miR-3152-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3152-5p Accession Number: MIMAT0019207 Mature Sequence: AUUGCCUCUGUUCUAACACAAG hsa...more | +inquiry | |
| AM2258 | MIRacle™ hsa-miR-1909-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1909-5p Accession Number: MIMAT0007882 Mature Sequence: UGAGUGCCGGUGCCUGCCCUG hsa-...more | +inquiry | |
| AM2257 | MIRacle™ hsa-miR-1293 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1293 Accession Number: MIMAT0005883 Mature Sequence: UGGGUGGUCUGGAGAUUUGUGC hsa-mi...more | +inquiry | |
| AM2256 | MIRacle™ hsa-miR-876-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-876-5p Accession Number: MIMAT0004924 Mature Sequence: UGGAUUUCUUUGUGAAUCACCA hsa-...more | +inquiry | |
| AM2255 | MIRacle™ hsa-miR-652-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-652-5p Accession Number: MIMAT0022709 Mature Sequence: CAACCCUAGGAGAGGGUGCCAUUCA h...more | +inquiry |
