Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir
Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM2194 | MIRacle™ hsa-miR-6854-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6854-5p Accession Number: MIMAT0027608 Mature Sequence: AAGCUCAGGUUUGAGAACUGCUGA h...more | +inquiry | |
| AM2193 | MIRacle™ hsa-miR-6804-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6804-5p Accession Number: MIMAT0027508 Mature Sequence: UGAGGGUGUCAGCAGGUGACG hsa-...more | +inquiry | |
| AM2192 | MIRacle™ hsa-miR-6754-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6754-5p Accession Number: MIMAT0027408 Mature Sequence: CCAGGGAGGCUGGUUUGGAGGA hsa...more | +inquiry | |
| AM2191 | MIRacle™ hsa-miR-6503-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6503-5p Accession Number: MIMAT0025462 Mature Sequence: AGGUCUGCAUUCAAAUCCCCAGA hs...more | +inquiry | |
| AM2190 | MIRacle™ hsa-miR-548au-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-548au-3p Accession Number: MIMAT0022292 Mature Sequence: UGGCAGUUACUUUUGCACCAG hsa...more | +inquiry | |
| AM2189 | MIRacle™ hsa-miR-4802-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4802-3p Accession Number: MIMAT0019982 Mature Sequence: UACAUGGAUGGAAACCUUCAAGC hs...more | +inquiry | |
| AM2188 | MIRacle™ hsa-miR-4747-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4747-3p Accession Number: MIMAT0019883 Mature Sequence: AAGGCCCGGGCUUUCCUCCCAG hsa...more | +inquiry | |
| AM2187 | MIRacle™ hsa-miR-4693-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4693-3p Accession Number: MIMAT0019785 Mature Sequence: UGAGAGUGGAAUUCACAGUAUUU hs...more | +inquiry | |
| AM2186 | MIRacle™ hsa-miR-3978 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3978 Accession Number: MIMAT0019363 Mature Sequence: GUGGAAAGCAUGCAUCCAGGGUGU hsa-...more | +inquiry | |
| AM2185 | MIRacle™ hsa-miR-4471 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4471 Accession Number: MIMAT0018998 Mature Sequence: UGGGAACUUAGUAGAGGUUUAA hsa-mi...more | +inquiry | |
| AM2184 | MIRacle™ hsa-miR-3935 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3935 Accession Number: MIMAT0018350 Mature Sequence: UGUAGAUACGAGCACCAGCCAC hsa-mi...more | +inquiry | |
| AM2183 | MIRacle™ hsa-miR-3622b-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3622b-3p Accession Number: MIMAT0018006 Mature Sequence: UCACCUGAGCUCCCGUGCCUG hsa...more | +inquiry | |
| AM2182 | MIRacle™ hsa-miR-4306 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4306 Accession Number: MIMAT0016858 Mature Sequence: UGGAGAGAAAGGCAGUA hsa-miR-430...more | +inquiry | |
| AM2181 | MIRacle™ hsa-miR-3150a-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3150a-3p Accession Number: MIMAT0015023 Mature Sequence: CUGGGGAGAUCCUCGAGGUUGG hs...more | +inquiry | |
| AM2180 | MIRacle™ hsa-miR-1827 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1827 Accession Number: MIMAT0006767 Mature Sequence: UGAGGCAGUAGAUUGAAU hsa-miR-18...more | +inquiry | |
| AM2179 | MIRacle™ hsa-miR-1290 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1290 Accession Number: MIMAT0005880 Mature Sequence: UGGAUUUUUGGAUCAGGGA hsa-miR-1...more | +inquiry | |
| AM2178 | MIRacle™ hsa-miR-889-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-889-3p Accession Number: MIMAT0004921 Mature Sequence: UUAAUAUCGGACAACCAUUGU hsa-m...more | +inquiry | |
| AM2177 | MIRacle™ hsa-miR-650 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-650 Accession Number: MIMAT0003320 Mature Sequence: AGGAGGCAGCGCUCUCAGGAC hsa-miR-...more | +inquiry | |
| AM2176 | MIRacle™ hsa-miR-579-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-579-5p Accession Number: MIMAT0026616 Mature Sequence: UCGCGGUUUGUGCCAGAUGACG hsa-...more | +inquiry | |
| AM2175 | MIRacle™ hsa-miR-519d-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-519d-3p Accession Number: MIMAT0002853 Mature Sequence: CAAAGUGCCUCCCUUUAGAGUG hsa...more | +inquiry |
