Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir
Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM2174 | MIRacle™ hsa-miR-18b-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-18b-3p Accession Number: MIMAT0004751 Mature Sequence: UGCCCUAAAUGCCCCUUCUGGC hsa-...more | +inquiry | |
| AM2173 | MIRacle™ hsa-miR-296-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-296-3p Accession Number: MIMAT0004679 Mature Sequence: GAGGGUUGGGUGGAGGCUCUCC hsa-...more | +inquiry | |
| AM2172 | MIRacle™ hsa-miR-125b-1-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-125b-1-3p Accession Number: MIMAT0004592 Mature Sequence: ACGGGUUAGGCUCUUGGGAGCU h...more | +inquiry | |
| AM2171 | MIRacle™ hsa-miR-107 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-107 Accession Number: MIMAT0000104 Mature Sequence: AGCAGCAUUGUACAGGGCUAUCA hsa-mi...more | +inquiry | |
| AM2170 | MIRacle™ hsa-miR-8089 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-8089 Accession Number: MIMAT0031016 Mature Sequence: CCUGGGGACAGGGGAUUGGGGCAG hsa-...more | +inquiry | |
| AM2169 | MIRacle™ hsa-miR-7113-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7113-3p Accession Number: MIMAT0028124 Mature Sequence: CCUCCCUGCCCGCCUCUCUGCAG hs...more | +inquiry | |
| AM2168 | MIRacle™ hsa-miR-6853-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6853-3p Accession Number: MIMAT0027607 Mature Sequence: UGUUCAUUGGAACCCUGCGCAG hsa...more | +inquiry | |
| AM2167 | MIRacle™ hsa-miR-6803-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6803-3p Accession Number: MIMAT0027507 Mature Sequence: UCCCUCGCCUUCUCACCCUCAG hsa...more | +inquiry | |
| AM2166 | MIRacle™ hsa-miR-6753-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6753-3p Accession Number: MIMAT0027407 Mature Sequence: UGGUCUGUCUCUGCCCUGGCAC hsa...more | +inquiry | |
| AM2165 | MIRacle™ hsa-miR-6502-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6502-3p Accession Number: MIMAT0025461 Mature Sequence: UAGACCAUCUUUCUAGAGUAU hsa-...more | +inquiry | |
| AM2164 | MIRacle™ hsa-miR-548au-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-548au-5p Accession Number: MIMAT0022291 Mature Sequence: AAAAGUAAUUGCGGUUUUUGC hsa...more | +inquiry | |
| AM2163 | MIRacle™ hsa-miR-4802-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4802-5p Accession Number: MIMAT0019981 Mature Sequence: UAUGGAGGUUCUAGACCAUGUU hsa...more | +inquiry | |
| AM2162 | MIRacle™ hsa-miR-4747-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4747-5p Accession Number: MIMAT0019882 Mature Sequence: AGGGAAGGAGGCUUGGUCUUAG hsa...more | +inquiry | |
| AM2161 | MIRacle™ hsa-miR-4693-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4693-5p Accession Number: MIMAT0019784 Mature Sequence: AUACUGUGAAUUUCACUGUCACA hs...more | +inquiry | |
| AM2160 | MIRacle™ hsa-miR-3977 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3977 Accession Number: MIMAT0019362 Mature Sequence: GUGCUUCAUCGUAAUUAACCUUA hsa-m...more | +inquiry | |
| AM2159 | MIRacle™ hsa-miR-4470 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4470 Accession Number: MIMAT0018997 Mature Sequence: UGGCAAACGUGGAAGCCGAGA hsa-miR...more | +inquiry | |
| AM2158 | MIRacle™ hsa-miR-3934-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3934-3p Accession Number: MIMAT0022975 Mature Sequence: UGCUCAGGUUGCACAGCUGGGA hsa...more | +inquiry | |
| AM2157 | MIRacle™ hsa-miR-3622b-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3622b-5p Accession Number: MIMAT0018005 Mature Sequence: AGGCAUGGGAGGUCAGGUGA hsa-...more | +inquiry | |
| AM2156 | MIRacle™ hsa-miR-4305 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4305 Accession Number: MIMAT0016857 Mature Sequence: CCUAGACACCUCCAGUUC hsa-miR-43...more | +inquiry | |
| AM2155 | MIRacle™ hsa-miR-3150a-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3150a-5p Accession Number: MIMAT0019206 Mature Sequence: CAACCUCGACGAUCUCCUCAGC hs...more | +inquiry |
