Home > Products > MicroRNA Agomir/Antagomir >
MicroRNA Agomir/Antagomir
MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.
MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.
MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
Click on the selected item to view the products:
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM0215 | MIRacle™ hsa-miR-4485-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4485-3p Accession Number: MIMAT0019019 Mature Sequence: UAACGGCCGCGGUACCCUAA hsa-m...more | +inquiry | |
| AM0214 | MIRacle™ hsa-miR-1268b miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1268b Accession Number: MIMAT0018925 Mature Sequence: CGGGCGUGGUGGUGGGGGUG hsa-miR...more | +inquiry | |
| AM0213 | MIRacle™ hsa-miR-3666 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3666 Accession Number: MIMAT0018088 Mature Sequence: CAGUGCAAGUGUAGAUGCCGA hsa-miR...more | +inquiry | |
| AM0212 | MIRacle™ hsa-miR-4253 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4253 Accession Number: MIMAT0016882 Mature Sequence: AGGGCAUGUCCAGGGGGU hsa-miR-42...more | +inquiry | |
| AM0211 | MIRacle™ hsa-miR-3165 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-3165 Accession Number: MIMAT0015039 Mature Sequence: AGGUGGAUGCAAUGUGACCUCA hsa-mi...more | +inquiry | |
| AM0210 | MIRacle™ hsa-miR-2115-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-2115-5p Accession Number: MIMAT0011158 Mature Sequence: AGCUUCCAUGACUCCUGAUGGA hsa...more | +inquiry | |
| AM0209 | MIRacle™ hsa-miR-1249-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1249-3p Accession Number: MIMAT0005901 Mature Sequence: ACGCCCUUCCCCCCCUUCUUCA hsa...more | +inquiry | |
| AM0208 | MIRacle™ hsa-miR-301b-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-301b-5p Accession Number: MIMAT0032026 Mature Sequence: GCUCUGACGAGGUUGCACUACU hsa...more | +inquiry | |
| AM0207 | MIRacle™ hsa-miR-658 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-658 Accession Number: MIMAT0003336 Mature Sequence: GGCGGAGGGAAGUAGGUCCGUUGGU hsa-...more | +inquiry | |
| AM0206 | MIRacle™ hsa-miR-591 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-591 Accession Number: MIMAT0003259 Mature Sequence: AGACCAUGGGUUCUCAUUGU hsa-miR-5...more | +inquiry | |
| AM0205 | MIRacle™ hsa-miR-499a-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-499a-5p Accession Number: MIMAT0002870 Mature Sequence: UUAAGACUUGCAGUGAUGUUU hsa-...more | +inquiry | |
| AM0204 | MIRacle™ hsa-miR-376b-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-376b-3p Accession Number: MIMAT0002172 Mature Sequence: AUCAUAGAGGAAAAUCCAUGUU hsa...more | +inquiry | |
| AM0203 | MIRacle™ hsa-miR-376c-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-376c-5p Accession Number: MIMAT0022861 Mature Sequence: GGUGGAUAUUCCUUCUAUGUU hsa-...more | +inquiry | |
| AM0202 | MIRacle™ hsa-miR-145-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-145-5p Accession Number: MIMAT0000437 Mature Sequence: GUCCAGUUUUCCCAGGAAUCCCU hsa...more | +inquiry | |
| AM0201 | MIRacle™ hsa-miR-7-1-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7-1-3p Accession Number: MIMAT0004553 Mature Sequence: CAACAAAUCACAGUCUGCCAUA hsa-...more | +inquiry | |
| AM0200 | MIRacle™ hsa-miR-7160-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7160-5p Accession Number: MIMAT0028230 Mature Sequence: UGCUGAGGUCCGGGCUGUGCC hsa-...more | +inquiry | |
| AM0199 | MIRacle™ hsa-miR-6865-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6865-3p Accession Number: MIMAT0027631 Mature Sequence: ACACCCUCUUUCCCUACCGCC hsa-...more | +inquiry | |
| AM0198 | MIRacle™ hsa-miR-6815-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6815-3p Accession Number: MIMAT0027531 Mature Sequence: UGGCUUCUCUUGCACACCCAG hsa-...more | +inquiry | |
| AM0197 | MIRacle™ hsa-miR-6765-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6765-3p Accession Number: MIMAT0027431 Mature Sequence: UCACCUGGCUGGCCCGCCCAG hsa-...more | +inquiry | |
| AM0196 | MIRacle™ hsa-miR-6514-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6514-3p Accession Number: MIMAT0025485 Mature Sequence: CUGCCUGUUCUUCCACUCCAG hsa-...more | +inquiry |
