Home > Products > MicroRNA Agomir/Antagomir >
MicroRNA Agomir/Antagomir
MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.
MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.
MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
Click on the selected item to view the products:
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM0135 | MIRacle™ hsa-miR-2110 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-2110 Accession Number: MIMAT0010133 Mature Sequence: UUGGGGAAACGGCCGCUGAGUG hsa-mi...more | +inquiry | |
| AM0134 | MIRacle™ hsa-miR-1247-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-1247-3p Accession Number: MIMAT0022721 Mature Sequence: CCCCGGGAACGUCGAGACUGGAGC h...more | +inquiry | |
| AM0133 | MIRacle™ hsa-miR-374b-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-374b-5p Accession Number: MIMAT0004955 Mature Sequence: AUAUAAUACAACCUGCUAAGUG hsa...more | +inquiry | |
| AM0132 | MIRacle™ hsa-miR-656-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-656-3p Accession Number: MIMAT0003332 Mature Sequence: AAUAUUAUACAGUCAACCUCU hsa-m...more | +inquiry | |
| AM0131 | MIRacle™ hsa-miR-550a-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-550a-3p Accession Number: MIMAT0003257 Mature Sequence: UGUCUUACUCCCUCAGGCACAU hsa...more | +inquiry | |
| AM0130 | MIRacle™ hsa-miR-527 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-527 Accession Number: MIMAT0002862 Mature Sequence: CUGCAAAGGGAAGCCCUUUC hsa-miR-5...more | +inquiry | |
| AM0129 | MIRacle™ hsa-miR-410-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-410-5p Accession Number: MIMAT0026558 Mature Sequence: AGGUUGUCUGUGAUGAGUUCG hsa-m...more | +inquiry | |
| AM0128 | MIRacle™ hsa-miR-302d-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-302d-3p Accession Number: MIMAT0000718 Mature Sequence: UAAGUGCUUCCAUGUUUGAGUGU hs...more | +inquiry | |
| AM0127 | MIRacle™ hsa-miR-143-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-143-3p Accession Number: MIMAT0000435 Mature Sequence: UGAGAUGAAGCACUGUAGCUC hsa-m...more | +inquiry | |
| AM0126 | MIRacle™ hsa-miR-139-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-139-3p Accession Number: MIMAT0004552 Mature Sequence: UGGAGACGCGGCCCUGUUGGAGU hsa...more | +inquiry | |
| AM0125 | MIRacle™ hsa-miR-7161-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-7161-3p Accession Number: MIMAT0028233 Mature Sequence: UAGAUCUUUGACUCUGGCAGUCUCCA...more | +inquiry | |
| AM0124 | MIRacle™ hsa-miR-6864-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6864-5p Accession Number: MIMAT0027628 Mature Sequence: UUGAAGGGACAAGUCAGAUAUGCC h...more | +inquiry | |
| AM0123 | MIRacle™ hsa-miR-6814-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6814-5p Accession Number: MIMAT0027528 Mature Sequence: UCCCAAGGGUGAGAUGCUGCCA hsa...more | +inquiry | |
| AM0122 | MIRacle™ hsa-miR-6764-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6764-5p Accession Number: MIMAT0027428 Mature Sequence: UCCCAGGGUCUGGUCAGAGUUG hsa...more | +inquiry | |
| AM0121 | MIRacle™ hsa-miR-6513-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-6513-5p Accession Number: MIMAT0025482 Mature Sequence: UUUGGGAUUGACGCCACAUGUCU hs...more | +inquiry | |
| AM0120 | MIRacle™ hsa-miR-5685 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5685 Accession Number: MIMAT0022475 Mature Sequence: ACAGCCCAGCAGUUAUCACGGG hsa-mi...more | +inquiry | |
| AM0119 | MIRacle™ hsa-miR-5007-5p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-5007-5p Accession Number: MIMAT0021035 Mature Sequence: UAGAGUCUGGCUGAUAUGGUUU hsa...more | +inquiry | |
| AM0118 | MIRacle™ hsa-miR-4757-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4757-3p Accession Number: MIMAT0019902 Mature Sequence: CAUGACGUCACAGAGGCUUCGC hsa...more | +inquiry | |
| AM0117 | MIRacle™ hsa-miR-4706 miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4706 Accession Number: MIMAT0019806 Mature Sequence: AGCGGGGAGGAAGUGGGCGCUGCUU hsa...more | +inquiry | |
| AM0116 | MIRacle™ hsa-miR-4645-3p miRNA Agomir/Antagomir | MicroRNA: hsa-miR-4645-3p Accession Number: MIMAT0019706 Mature Sequence: AGACAGUAGUUCUUGCCUGGUU hsa...more | +inquiry |
