Home > Products > MicroRNA Agomir/Antagomir >

MIRacle™ mmu-miR-21a-3p miRNA Agomir/Antagomir

Product Name

MIRacle™ mmu-miR-21a-3p miRNA Agomir/Antagomir

Price Get Quote
Cat.No

AM2840

Species

Mouse

Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Description

MicroRNA: mmu-miR-21a-3p

Accession Number: MIMAT0004628
Mature Sequence: CAACAGCAGUCGAUGGGCUGUC

 

mmu-miR-21a-3p is a microRNA that plays a significant role in various biological processes and diseases. It is involved in angiogenesis, particularly through regulating the PI3K p110α pathway, which is essential for endothelial regeneration and angiogenesis. In addition, mmu-miR-21a-3p has been associated with epilepsy in mice. It targets SNCA, and its overexpression causes a considerable increase in SNCA expression, indicating a potential involvement in the development of epilepsy. Furthermore, mmu-miR-21a-3p has been found to be significantly correlated with the immune regulator Acvr2a. The expression of mmu-miR-21a-3p and Acvr2a is opposite after asthma and BM-MSCs treatment, suggesting that the miR-21/Acvr2a axis plays a crucial role in the induction of asthmatic inflammation.

 

Click here to browse detailed information about mmu-miR-21a-3p in miRBase.

 

Introduction and Application of mmu-miR-21a-3p miRNA Agomir/Antagomir

mmu-miR-21a-3p miRNA Agomir is a chemically modified double-stranded small RNA that mimics the endogenous miRNA. It can regulate the biological function of target genes by posttranscriptional degradation of mRNA or translational inhibition of protein expression. On the other hand, mmu-miR-21a-3p miRNA Antagomir is a chemically modified miRNA antagonist. It competes strongly with mature miRNAs in the body, preventing their binding to target genes. This inhibition of miRNA function provides a means to study and modulate the expression of specific genes.

 

Why choose mmu-miR-21a-3p miRNA Agomir/Antagomir from AcceGen?

AcceGen offers mmu-miR-21a-3p miRNA Agomir/Antagomir, providing lasting effects for up to 5-6 weeks due to enhanced stability. With a wide range of miRNAs covered, including mmu-miR-21a-3p, researchers can conduct in vitro and in vivo miRNA functional studies. AcceGen’s expertise ensures reliable tools for investigating the biological functions and mechanisms of mmu-miR-21a-3p.

Recommended Medium And Supplement
Citation Guide

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Label

FAM, CY3, CY5, etc. (optional)

Application

For research use only

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Component

mmu-miR-21a-3p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Product Type

microRNA Agomir/Antagomir

Product Image AcceGen Frozen Cells & Cell Lines AcceGen Frozen Cells & Cell Lines
Tech Document

MIRacle™ Agomir Product Manual

MIRacle™ Antagomir Product Manual

MSDS-AcceGen MicroRNA Agomir

MSDS-AcceGen MicroRNA Antagomir

  • ONLINE INQUIRY
  • PRODUCT REVIEWS
We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time?

Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
Privacy Policy: AcceGen will never sell, rent, or share your personal information with any third parties without your express permission.
Reviews of MIRacle™ mmu-miR-21a-3p miRNA Agomir/Antagomir
AcceGen is always trying to do right by our customers and working hard to build a higher quality product.

Your email address will not be published.

AcceGen Scroll Top Button
Copy link